Gene detail

Detailed information of OS493_030419-T1 in Lophelia pertusa

Genomic Location: scaffold_195:570685...605355
NR annotation: KAJ7377217.1, DNA repair endonuclease XPF [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_030419-T1

ATGGCGGCACTATCTGAATATGAAAATTCGATGTTTCTTGAGCTTATGGATGACGATGGGCTGTTCGTCACAGCTAAGGGACTGAGTATAGAGCGTGTTATCACGAATTTTCTGAAGATCCATTGTGTCACAAGTGATCCTTCGTCCATTTCATTAGTCCTTGTAATCAACACAACAGATCAGGAAGAAGACTACATACTTGATGAACTGAAGTCTTCAGATGTTCCGCTACCAAAAGTTATCACCACTGAATTCAGTTCATCTGAGAGGGAGTCTGTGTACCTCAGTGGAGGTGTGCTGTTTGTCACGTCAAGAATCTTGGTCGTGGATATGCTGACCAAGAGGCTTCCCATTCATCTGGTGACAGGAATTGTTGTCTACCGCGCTCATAAAATCATTGAATCTTGCCAAGAGGCTTTCATACTACGACTCTACAGAGAAAACAACAAGACTGGTTTCATTAAAGCCTTCTCAGATAATCCTCAGGCTTTCACTAATGGCTTCTTTCAAGTGGAGAAAGTGATGAAGAACTTGTTTGTTCGAAAACTCTATCTCTGGCCCAGATTTCATGCAACAGTTTCAGCTTTTCTGGAAAAGCACAAGCCAGAGGTTATTGAGCTTCACCTTCACTTAACACCCTCCATGCTGGCCATCCAGACGGCAGTTCTTGATTTGACTGACACCTGTCTAAAAGAACTGAAGAGAGCAAACCCAACGCTTGATGCAGATGATCTTACAGTGGAGAACAGCATCAGCAAGTCTTTTGACAAAATTCTGAGATTTCAGCTAAATCCTGTCTGGCATCAACTGGGAAACAAGACAAAGCAATTGGTTGCTGATCTTAAAGTACTGAGGCTGATTTTACTGTACCTAACACAGTATGACTGCATCACATTCTACAACTTTCTGGAATCATTAAGGGCCAGTCAGCGCGATGTCAAGAATCATTCCCTTTGGATGTTCATGGATGCCGCAGATTCCTTGTTTGTGCATGCAAAAGACAGAGTTGTGGAGTACACTGAGAGGAAAAACAAGAAGATGAAAGGAGAGAAAACAAAACAGAAAGATGACAAGAATCTTAGTTCTGACATTGAGAAGGAACAGAAAGAGGAACTTGTTTTGGAAGAGAGTCCAAAGTGGAAGCTACTCGCGGATGTCTTGGACGAGATAGAACGTGATGATGCCAAGAATGATACCAAACTTGGTCCGGGCCATGTACTGATAGCTGCTTATGATGAGAGAACATGTTCACAGCTCAGAGATTATCTCTGTGATGGTGGCGAAGCTGTGCTCAAACATCTTTACAACAAGTTGATTAAGAATCCAACAACAGTGGCTGAAACTACAGAAACAGCTTCTTTCAGTGGAGAAACTTTGCGAGGTTATGCTGTTGCAGATGTTGCTAAGAAAGCGGATGTACCATCATCGCGTCAACGTAAAGCCAGAGCTAAGGCTGGAGACAAAGGCAATGCCAAAGGGAAAGTTGCTGCAACAAAGAACACTGTGAATACAGATGACTCAAATGATGGAACAATTGCATCAACCACACAGTTATTCAAAGGCTCAAGATCTAATGTTATCTTAAGGCCAGGTGAAGAAGATAACAAAGGGGAAGAAGAGGGTTCACCGCCAATAAAACTGTTGTCTTCGCGAGTGGTAATCATTCATCCTCTGACAGGATGCAGTGATCGCTACAGTTTACTGAGAACTCTTTGTGAAGTTGAGCCACGCTATGTTGTGCTGTATGATGCACAAATGCAGTTCATACGGCAGCTCGAGGTTTACAAGGCTTCAAGACCTGGAATTCCTCTTCGTGTTTATTTCTTAATTTACACTGGCTCTGTCGAGGAACAGAAATACTTAACAACTCTTCGCAAAGAAAAGGAAGCATTTGAGGCGCTCATCAAAGATAAAGGAACCATGGTTGTCCCCGAGGAGCGAGAAGGCAGAACAAGCGCGGCCATGATGTTGAGTAGAGATCCATCCAAGGCTACTGATGCTGTGAGCACACGGAAAGCAGGAACACGTGACGGAGACAACAAGACACCGAGAAAGGTCATTGTCGACATGCGTGAGTTTCGCAGTGAGCTTCCTTCCCTGATACATCGGAGAGGAATTGATATAGAACCTGTCACATTAGAGGTCGGGGACTACATTCTCACTCCAGATATGTGTGTGGAACGGAAGAGTATAGGTGATTTGATTGGCTCTCTAAACAATGGAAGACTGTACAACCAGGCGGTTTCAATGACCAGGTTTTACAAAAGACCCATTCTTTTGATTGAATTTGACCCTAACAAGTCATTTTCATTACAGTTGAGAATCTTGTGGTGCCATAGTCCTTATGCAACTGCTGAATTGTTCGACGATTTGAAGACGAATTATCCTGAGCCAGATGCTAACACAGCCATGGCGGTTGGATCTGACCCTACAGCAGCAGCCGCTGATATTACCTACAACATAGGACCACAGGACTTTATTTTGAAGCTTCCAGGGATAAATTTCAAGAACTACAGATTTATTATGCAAAACGTCGAGAGTGTTCAAGAACTGTTCACGTTGTCACAAGAAAGACTCGCAGCTATTTTAGGCAATGCTGGCAGTGCCAAGCAATTGTGGGAGTTTATTCACGCCGATAACAAGCCTCACGCGAAGGCACCAACTTCCTTGAATGTCAAAAGATGA

Transcript

OS493_030419-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q92889	DNA repair endonuclease XPF OS=Homo sapiens OX=9606 GN=ERCC4 PE=1 SV=3
Q9QYM7	DNA repair endonuclease XPF OS=Cricetulus griseus OX=10029 GN=ERCC4 PE=2 SV=3
Q9QZD4	DNA repair endonuclease XPF OS=Mus musculus OX=10090 GN=Ercc4 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002037 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02732 all species →	ERCC4	ERCC4 domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006166 all species →	Domain	ERCC4 domain	Interproscan
IPR010994 all species →	Homologous_superfamily	RuvA domain 2-like	Interproscan
IPR011335 all species →	Homologous_superfamily	Restriction endonuclease type II-like	Interproscan
IPR047520 all species →	Domain	DNA repair endonuclease XPF, nuclease domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10150 all species →	DNA REPAIR ENDONUCLEASE XPF	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0004518 all species →	Molecular Function	nuclease activity	Interproscan
GO:0000014 all species →	Molecular Function	single-stranded DNA endodeoxyribonuclease activity	Interproscan
GO:0000110 all species →	Cellular Component	nucleotide-excision repair factor 1 complex	Interproscan
GO:0000712 all species →	Biological Process	resolution of meiotic recombination intermediates	Interproscan
GO:0000724 all species →	Biological Process	double-strand break repair via homologous recombination	Interproscan
GO:0003684 all species →	Molecular Function	damaged DNA binding	Interproscan
GO:0003697 all species →	Molecular Function	single-stranded DNA binding	Interproscan
GO:0006296 all species →	Biological Process	obsolete nucleotide-excision repair, DNA incision, 5'-to lesion	Interproscan
GO:1901255 all species →	Biological Process	nucleotide-excision repair involved in interstrand cross-link repair	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10848	ERCC4, XPF; DNA excision repair protein ERCC-4	EC:3.1.-.-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_030419-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

107TPM > 0

7Conditions

16.9Max TPM

4.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.61	10.94
polyp at pH7 6	18	16	5.65	11.20
coral polyp · control treatment	16	16	4.47	7.83
coral polyp · oil and dispersant treatment	16	16	3.07	6.57
coral polyp · oil treatment	16	16	4.70	8.99
coral polyp · dispersant treatment	16	16	3.72	9.32
Polyp	10	9	6.16	16.91

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.94
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.21
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.07
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.67
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.40
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.03
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.78
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.66
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.39
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.88
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.63
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.39
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.80
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.64
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.63
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.43
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.28
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.20
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.20
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.14
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.13
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.31
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.49
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.35
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.07
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.01
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.59
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.85
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.53
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.85
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.83
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.76
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.99
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.58
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.83
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.65
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.16
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.96
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.95
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.68
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.74
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.29
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.69
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.56
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.54
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.53
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.44
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.46
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.16
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.87
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.57
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.10
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.53
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.29
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.29
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.54
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.12
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.76
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.68
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.62
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.18
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.79
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.67
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.61
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.25
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.10
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.99
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.27
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.90
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.20
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.05
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.88
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.20
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.10
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.90
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.88
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.83
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.81
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.33
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.01
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.64
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.29
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.32
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.99
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.70
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.34
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.18
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.77
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.61
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.92
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.77
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.63
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.60
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.45
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.02
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.30
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.20
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.63
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	16.91
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	13.30
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	8.49
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.90
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.46
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.73
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.15
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.58
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.04
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.