Gene detail

Detailed information of OS493_030952-T1 in Lophelia pertusa

Genomic Location: scaffold_206:185748...195872
NR annotation: KAJ7383065.1, 7-methylguanosine phosphate-specific 5'-nucleotidase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_030952-T1

ATGTTTGGAATCGCTGCTGTTGGATTGTCCGCCGTTGCTGGCTATGGCGTTTACAAATATGTACAAGGGAAACAGAATGCTCGAAAGATCAAGGAAGCAGTCGACGAGATGATTAAAAATATTGACAAGCCAAATGTCTACATCAGAGATTCAGTTGGGGTACGAGAAAAACTCAAGTTACTCTATGAGGGAGGACCTGAAAAGCTGCAGGTCATCTCAGACTTTGATAAGACACTCACAAAATTTGTCATCAATGGAGAAAAAGGCTGCACAGTGTATGGTGTCATCGAGAGCTGCAAGTTGTTCCCAGAATCATACAGAGAAACGGCCAAAGAACTCAAAGAAAAGTACATGCCAATTGAATTTTCAGGAGAACTTTCATCTGAAGAGAAATTACCACATATGGTGGAATGGTGGACCAAGTCACATGGGTTACTCACTGAGCTTGGTATCAAGAAGGACATCCTGTCTCAGGTAGTGGAAGATGCACCAATTGCTCTGAGGTGGACAAAGGGCAATGAACTCATTACTGAGCTGAAACTCAAGCAAAGTCAAATTCCTGAAATTGTAAAAGATGCGCACATCGCTCTGAGAGATGGTGTGGAGTGGTTCTTTGTCAAACTACACGAGAAGAATGTTCCTGTTCTGATTATATCCGGTGGACTTGGAGATGTGATTAAAGAAGTGATTGATCAACAAAGTACTATGTACGACAATGTTAACATTGTGGCCAACTTCTTTAAGTTTGAGCAGTGGACGCATAAAAGTGGGACACATAAAAGTGGACGCACAAAAGTGGACGCACAAAAGTGGACGCATCAAAGTGGACGCATCAAAGTGGACGCACTAAAGTGGACGCACCAAAGTGGATGCACCAAAATGGATGCACCAAAAGTGGATGCACCAAAGTGGACGCACCAAAGTGGACGCACAAAGTGGACGCACCAAAGTGGACGCACTAAAAGGGGACGCACAAAAGTGGACGCACAAAAGTGGATGCACAAAGTGGACGCACAAAAGTGGACGCACAAAAGTGGACGCACAAAAGTGGACGCACAAAATGGACGCAGTAAAGTGGACGCAGTAAAGTGGACGCACCAAAGTGGACGCACTAAAGTGGACGCACAAAAGTGGACGCACCAAAGTGGACGCACAAAAGTGGACGCACTAAATGGACGCACCAAAGTGGACGCACAAAAGTGGATGCACAAAAGTGGACGCACAAAAGTGGACGCACAAAAGTGGACGCATCAAAGTGGACGCATCAAAGTGGATGCACCAAAGTGGACGCACCAAAGTGGACGCACCAAAGTGGACGCACCAAAGTGGACGTATCAAAGTGGACGCACTAAAGTGGACGCACGAAAGTGGACGCACCAAAGTGGACGCACCAAATGGACGCATAAAAGTGGACGCATAAAAGTGGACGCATTAAAGTGGACGCACAAAAGTGGACGCACAAAAGTGGACGCACAAAAGTGGACGCACAAAAGTGGACGCACAAAAGTGGACGCACAAAAGTGGATGCATAAAAGTGGACGCATAAAAGTGGACGCAGTAAAGTGGACGCATGGACGCACAAAAGTGGACGCACCAAAGTGGACGCACAAAAGTGGACGCACTAAAGTGGACGCACTAAAGTGGACGCACCAAAGTGGACGCACAAAAGTGAACGCACCAAAGTGGACGCACCAAAGTGGACGCACTAAAGTGGACGTATCAAAGTGGACGCACAAAAGTGGACGCACAAAGTGGACGCACAAAAGTGGACGCACAAAATGGACGCACAAAAGTGGACGCACAAAAGTGGACGCACCAAAGTGGACGCACCAAAGTGGACTCACAAAAGTGGACGCACTAAAGTGGACGCACAAAAGTGGACGCACAAAAGTGGACGCACTAAAGTGGACGCACAAAAGTGGACGCATCAAAGTGGACGTATCAAAGTGGACGCACAAAAGTGGACGCACAAAAGTGGATGCATCAAAGCGGACGCATCAAAGTGGACGCACTAAAGTGGACGCACTAAAGTGGACGCATCAAAGTGGACGCACAAAAGTGGACGCATCAAAGTGGACGCATCAAAGTGGACGCACAAAGTGGACGCATCAAAGTGACGCACCAAAGTGGACGCACCAAAGTGGACGCACCAAAGTGGACGCACCAAAGTGGACGCATCAAAGTGGACGCACAAAAGTGGACGCATAA

Transcript

OS493_030952-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5ZID6	Cytosolic 5'-nucleotidase 3A OS=Gallus gallus OX=9031 GN=NT5C3A PE=1 SV=3
Q9D020	Cytosolic 5'-nucleotidase 3A OS=Mus musculus OX=10090 GN=Nt5c3a PE=1 SV=4
Q9H0P0	Cytosolic 5'-nucleotidase 3A OS=Homo sapiens OX=9606 GN=NT5C3A PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003751 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF05822 all species →	UMPH-1	Pyrimidine 5'-nucleotidase (UMPH-1)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036412 all species →	Homologous_superfamily	HAD-like superfamily	Interproscan
IPR023214 all species →	Homologous_superfamily	HAD superfamily	Interproscan
IPR006434 all species →	Family	Pyrimidine 5'-nucleotidase, eukaryotic	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13045 all species →	5'-NUCLEOTIDASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0008253 all species →	Molecular Function	5'-nucleotidase activity	Interproscan
GO:0000287 all species →	Molecular Function	magnesium ion binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_030952-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_030952-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

104TPM > 0

7Conditions

11.8Max TPM

3.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	4.23	11.80
polyp at pH7 6	18	16	4.02	9.42
coral polyp · control treatment	16	16	2.80	4.53
coral polyp · oil and dispersant treatment	16	15	2.70	5.51
coral polyp · oil treatment	16	15	2.77	5.54
coral polyp · dispersant treatment	16	15	2.34	4.17
Polyp	10	9	1.74	4.07

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.80
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.49
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.92
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.08
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.84
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.04
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.68
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.27
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.74
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.28
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.99
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.95
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.78
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.76
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.72
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.38
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.28
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.16
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.42
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.36
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.84
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.38
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.82
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.14
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.02
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.95
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.85
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.75
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.56
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.84
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.54
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.36
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.33
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.24
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.53
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.31
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.83
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.75
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.59
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.96
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.89
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.82
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.68
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.45
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.43
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.37
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.19
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.60
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.35
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.08
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.51
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.89
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.61
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.42
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.34
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.32
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.99
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.85
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.76
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.41
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.39
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.68
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.44
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.35
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.23
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.54
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.12
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.61
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.58
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.56
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.46
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.43
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.18
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.83
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.64
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.60
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.05
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.84
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.10
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.74
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.00
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.17
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.64
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.46
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.42
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.23
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.03
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.00
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.36
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.34
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.21
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.98
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.57
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.39
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.37
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.22
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.07
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.66
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.05
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.02
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.76
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.66
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.92
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.82
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.43
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.