Gene detail

Detailed information of OS493_031224-T1 in Lophelia pertusa

Genomic Location: scaffold_213:291...15375
NR annotation: KAJ7376952.1, Coiled-coil domain-containing protein 39, partial [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_031224-T1

ATGGATGACATTGTGAGTGAGATGAACTTCGATGAAGGCATTGCCATGCCAGTGGCAAATGTCGAGAATAAACAGCTGGAGAGTGAGGTAACTGACACTCAGAAGAATATAACATCATATAACGATCAGCTTGATGAACACTCGGACAGAATCTATGCCATGGGTGAACATCTCAGAAATGTACAACAAGAACTGCAACATACACAGGATTTGCTTAATGCAAGGAAGAGAGAGATTGAGACTGAAAATCACATGAAACAGATAGCTCAGCGAGAAGAGGGAAGACTTGGTAATGAAATCAGGAGAATAAACAATAACATCAAAGATTTGACAGAGAAGAGGAATATCCTTGAGAACAACATTTTCAGGAATACACAGCGGCTTGAGGACCTTAAAAGCCAGATGAACTGGGATCAGAAGGCACTCGAGGCATGGCTGGAGGAATCTGCAAGGAAAGATGAAGATGCACTGACACTACAAAAGTACACTCGTTCAGATGAAGGCAAAGTGAAGGAACTAACGCTAAGGATGGAAAGAATGACAGATGATGCTGCGAAGAAAAGGAGAGAACTGGAGCATGAACTAACACTCACCATGACAGCTCAGATTGAGTTAGACAAGACAGCTGAGGAGTTCCGCAAGGCACACAGCGAGAGACAAGAGTTGCTGCGGCAGTGGGAGAGCACCATTGAACAGATGCAGAAGAGGGACAGAGAGATGGATCAACTGGCCGTGAAACTTGCAGAGGTAAAGCTGGAGGTGAGAGACAGAGAAGAACAAGTCCAAGAGAAACAGAAATTTCTGGAGAGCGAGCTTGCCAACAATCAAGAAAAGGAGAAGAAAGTTGGGGTGGCTGAGAGACAGGCAGCTAAACAGCGACTGGAGTACCAGGACGCTGAGCAGATCCGCATTCAATTCCAAGATGAGCTTGACACTCTGAAATACACTGTGGATAGAACAGCAAGGGATCTTGACAGTGCCAGACAAAAATACAACTTACTCAAGAAAGAAGTTACCAGCAGAGCAGATAGGCTTGAGAGAGTCCAAAGGGAGCGAGATGATCTGCGACACCAGCTGAAAATTGTGACTGATGATACTATGACTGCTGAAGAAAAGGCACAACTCATGGACACATTGTTAAAGGAAGAGGAAGCAAGGATTTATGATGTGGAAAAACAACTGGCTAGACTGCGTGAAACACAGTTCAGAAAAACAGAAGAACTGCACCAAAGTAAAGTTTTGGAAAGCAATACTGCAGCAGAAATTCAGGGTGCTCGTGCTGCCAGTAGGAACTTGAGTAGCAAACTACACAAACTTGACCAGGAATCACTCAAACAACAGGAAATTATTTATATGCAGGATTTTCAGCTTCAGCAGTTAGAGCGTAGAATAACCCGCATGCAGGGAGAGCGAACCAATGAAGAGAAGTTACAACTTGAGGCCAGGATTAAGGAATTGATGTCTCAAATGGATGAACATAACTCGACTCACACACTTCTCAGCGCTCAGATGAAGAACTTAAACGATGATCTGCGACGTGCTAACCGAGATTTAGACAAAGGAAAAGACGAAATGAAAAATCTTACAAGCAAAATTGAGGAATTGAATCTTCACAACGACAGCTCTGAGAGGGAAAGAAAGAAAGTTGTGGCCTTAAAACAGAATCTTATGGTGGATGAGAACATTCTGAAGCTGGAGGTCAAACGCCTCAGAGAAACGCTCAGCAGCAAAGCAGACAATGTGTTTAACTTGGAGAAGAGAAAACTTCAATTAGAGACGGCGATGCAGCAGCGCCGCCATGAAATCGACATCCACAAAGACATGCTGAAAGCGCAGATCAAATCCTCTGAAGAGGAAAGGCAGACTGTCAGGTATGAAATCCTCATGATCTCCATGGCGCCTCCCGAGGGGGAGGAGGAGAGGTCTCAAGCCTATTACGTCATCAAGGCAGCTCAAGAGAAGGAAGAACTTCAGCGAGAAGGCGATGAACTGGACGCTAAGATCAGAAAAGCTGAGAAAGAGATCCGGGCGCTGGAGAACACACTGCGCTTAATGAACGGCCGTAATGAGACTTACAGGAAGAGCTTTAACAAGGTGGATGAGATGAGTGAAGAGTTTGACGAGAAGCAGCGGATGGAGGATCAGATGCGAGCTGTTATGGACAAATACAAATACAAACGACGACAAATCCGTGAGCTACAGGAGGACCTGGGCTCCATGCAAAGCACGCTGGACAACTTGACCGCGGACGAGCAAGGCTTGGTGGAAGTGATCACCGAGAAACAAGCCAAGACGACAAATTTACAGAAAGAACTGGACGATCAGAAGATAAAGAAGGACAGAGCGGCTCGTGAGGGGAGTAAGATAGCTCGCGCTGTAAGGAGTGCTAAGAAAAGCTCAGGGGAACTACACGAGGAGAAGGATATGGATTTAAGAGAACTGCGTGAGTATAACACGCGTACGATGAAACAGATGGGCGAGGTGCTACACAGTCACCCGGATCTTGGTCCCAGTATCCAGATCTACTTTAGCCAGGCCGGGCTACCAATGCCGCCTTCCCCAGGCCCTGGTATGTCGCGGCCAACCTCGTCCCGTAGCTCCAGGAGTTCTGGAACAGTGTCATCCGCTAGATCTGATATTTCCACTGGCAGTCGCCGAGGTGTCGTGGACATAGGAGCTCTGGCTCTTACTGGAGCCGCAAGTCCCAAGACAGGTGTCTCTCCTTCAGGTAGTGCGCGAGGAAAGAAGACGAGTTCCAGGTCTGGCTCCGCAGCTGGTTCCAAGGCCTCCTCTCGAGCCGGCAGCGCGGCCAGTCGCCGCAGCACAGAGCAGC

Transcript

OS493_031224-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q0V9R4	Coiled-coil domain-containing protein 39 OS=Xenopus tropicalis OX=8364 GN=ccdc39 PE=2 SV=1
Q9UFE4	Coiled-coil domain-containing protein 39 OS=Homo sapiens OX=9606 GN=CCDC39 PE=1 SV=3
E2R1I5	Coiled-coil domain-containing protein 39 OS=Canis lupus familiaris OX=9615 GN=CCDC39 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006393 (this species only) · gene tree & orthology

Pfam domain

No Pfam domain signature was recorded for OS493_031224-T1 in Lophelia pertusa.

InterPro

InterPro term	Type	Description	Source
IPR033290 all species →	Family	Coiled-coil domain-containing protein 39	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR18962 all species →	COILED-COIL DOMAIN-CONTAINING PROTEIN 39	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003341 all species →	Biological Process	cilium movement	Interproscan
GO:0005930 all species →	Cellular Component	axoneme	Interproscan
GO:0036159 all species →	Biological Process	inner dynein arm assembly	Interproscan
GO:0060285 all species →	Biological Process	cilium-dependent cell motility	Interproscan
GO:0060287 all species →	Biological Process	epithelial cilium movement involved in determination of left/right asymmetry	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K23729	CCDC39; coiled-coil domain-containing protein 39	-	Domain-containing proteins not elsewhere classified	ko04990	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_031224-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

63.0Max TPM

19.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	17.39	25.42
polyp at pH7 6	18	18	16.49	27.75
coral polyp · control treatment	16	16	25.49	50.18
coral polyp · oil and dispersant treatment	16	16	21.25	62.98
coral polyp · oil treatment	16	16	20.78	31.47
coral polyp · dispersant treatment	16	16	20.19	32.47
Polyp	10	10	16.73	26.26

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.42
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.84
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.53
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.73
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.89
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.67
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.30
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.05
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.04
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.92
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.16
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.81
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.47
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.11
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.01
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.63
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.76
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.75
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.75
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.15
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.89
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.36
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.69
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.35
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.10
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.56
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.16
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.71
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.13
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.71
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.40
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.15
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.95
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.37
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.18
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.23
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.18
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.28
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.88
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.61
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.09
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.39
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.32
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.10
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.07
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.97
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.67
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.64
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.10
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.97
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.13
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.35
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	62.98
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.64
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.03
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.65
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.91
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.27
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.34
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.77
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.39
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.37
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.00
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.99
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.85
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.20
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.78
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.73
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.47
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.86
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.86
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.11
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.52
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.96
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.52
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.02
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.42
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.56
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.54
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.52
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.55
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.29
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.44
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.88
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.47
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.23
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.85
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.14
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.15
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.96
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.10
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.30
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.87
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.59
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.27
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.87
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.64
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.25
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.16
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.24
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	26.26
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	21.30
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	19.44
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	17.04
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	16.58
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	15.89
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	15.76
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	15.10
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	13.47
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	6.47

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.