Gene detail

Detailed information of OS493_031284-T1 in Lophelia pertusa

Genomic Location: scaffold_213:476080...494098
NR annotation: KAJ7377011.1, Nucleoside diphosphate kinase 7 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_031284-T1

ATGTATGACATAAAGAATCGTCGTCTTTTTCTGAAACGATCGCTGATAGATGGCCTTCAGCTTCACCATCTTTTCACTGGAGCCATTATCAACATTCATTCTCGTCAGTTAACCATAACAGACTATGCAGATGATCGTACATCAAACCTTCTGAAAACAAGAATGAGACGGAGTATTATTGACATGATCCACCAGGGAGACTTCCTCATTTGTCAAGCCAAGATGATCAGGATGACAAGCAATCAAGCGTCAATATTCTATGAAGAACACAAGGGAACTTCTTTTTTCAATTATTTAGTGGAATTTGTCACAAGTGGTCCTGTTGTTGTCATGGAGCTGAAGGGTTCAAACGCTATTCAAAAATGGCGGACACTGTTAGGTCCAACCGACTCGGCGACTGCACGCACCCAGGCTCCATTGTCAGTCAGAGCCAAGTTTGGCACAGACAATACAAAGAATGCCGCACATGGCTCAGACTCTCCTGAATCAGCTAACAGAGAAGTTGATTTTTTCTTTGGTGGTCAAATATTTGGTGGCAAAAATACCGCTACATTCTCCAACTGCACTCTGTGCATAATTAAACCCCATGCTATTATTGAAGGTCTCACTGGCAAAATCATCTCAGCCATAATCAGCAAGGGTTTTGAAATTTCTGCAGTTCAGATGTTCCATCTTGAAAGAGCCAATGCAGAAGAATTTCATGAAGTTTACAAAGGTGTGGTAAATGAATACAAGAGTATGGTTGAAGAACTGTGTTGTGGTCCGTGTCTGGCCATGGAGATTAGAGCACCGGCCGATGCACCTGTCGCATTCAGAGAATGCGTTGGCCCTGCTGATCCTGAAATCGCTCGACATCTACGTCCAGGAACATTACGAGCAATGTTTGGTAAAGATAAGATCAAAAACGCTGTACACTGCAGCGATCTACCAGAAGACGAACTTTTCAGTAAAATACTTACCATGAAGGCAGGCAGCCAGTGGATGGGACTTCTGTTTCTGTGGCTGTACCAATTTGACCGTTGTTCATCGATGGCCAGTGATAATAATCAAGTGTGCGTGATGAAGAGTGTTAATGGTAGTGATGTGACTAAGTGTTATGATTATGGCTGGGCAAGTTTTGGTGAAGTCATCAGTCCTCCTAATATAAAGGGTGTTGTTGTCTTGGCTGACCCTACTAGAGCATGTACGTCAGTAAAGCACCAGAGTAGTTATAACCAATCAGGTTACTCTGGGATGTGGTTCCTCCTCGTTGACGTGGGTGACTGTGAATTTGATACCAAGCGACTGTTCAACTTCTGTAGAAATCGATCGCAAGTCGCGTCGGTTTATGTCGCTGCTCAAAGAGAATCGTTACTTCTTTGTGATTCTTTGAGCTCCATGGATCTATCTGAAAAGAGGAAGCTTGTCCCAACTGGAGCAACTCCAAAGAAGCCAGAAAAAATCAAGAAGAAAGCCAGCGAAAGTCAGGAAAATGCCACAAGTTCTTCGCGGTCGCCACTTGCGACAACAACAAATCACGAAGGAAAGCACGGTTACCAGGGAGCCATGGCCACTGAAGGAGGGTTTGATGCCGCCATTATCAGGAGTTTGGAAAGTGATGTTGTTCAACACATCGGAGGAGATGACAGAAAAGTTAAATTGCCAGTGGTTTATGTAGGCGAGAGCACTGGTCAAAACTTGGAAGATAATGATTTTAGAAAGAAGCCGAGCAGTAGAATCTTGCTTACTCCACAGCAGTATCCACCAATATGGAATTATGAATTCTACATGATTCCCTTTGCAATCATTGTGGGAATCTGTTTTATTTTGATGGCTATGTTCATGATCAGTCGTTACTACAGGCACTACCTAGAGCAGCGACGGAACAGGCTCTCCCCAACAAATCTGAGAAAGATTCCAACAAAAAAGTTTAAAAAAGGAGATGATTACTATGATGTGTGTGCCATTTGTTTGGAGGAATACAGAGATGGAGAAAGGCTGCGAATCCTGCCTTGTGAGCATACCTACCACTGCAAGTGTGTAGACCCATGGCTAACAGAAGGGAAGCGGACATGTCCCGTGTGCAAACGACCTGTAACAAATGACAAGAAAACGAGAAACCGCCGAGCTGATGTGGAGACGGCAGGAGAGTCCACTAATGACGCTGATGAGACAACTCCTCTCATCGCATCAACTTCTCATTCAGCCGGCACCTCCAACTCCATGACAGTTTAG

Transcript

OS493_031284-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9Y5B8	Nucleoside diphosphate kinase homolog 7 OS=Homo sapiens OX=9606 GN=NME7 PE=1 SV=1
Q9QXL8	Nucleoside diphosphate kinase homolog 7 OS=Mus musculus OX=10090 GN=Nme7 PE=1 SV=2
Q9QXL7	Nucleoside diphosphate kinase homolog 7 OS=Rattus norvegicus OX=10116 GN=Nme7 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004725 (this species only)
Ubiquitin family	E3\|E3 activity RING\|RING · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00334 all species →	NDK	Nucleoside diphosphate kinase	Domain	Interproscan
PF13639 all species →	zf-RING_2	Ring finger domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan
IPR036850 all species →	Homologous_superfamily	Nucleoside diphosphate kinase-like domain superfamily	Interproscan
IPR037993 all species →	Domain	NDPK7, second NDPk domain	Interproscan
IPR023005 all species →	Active_site	Nucleoside diphosphate kinase, active site	Interproscan
IPR034907 all species →	Domain	Nucleoside diphosphate kinase-like domain	Interproscan
IPR001564 all species →	Family	Nucleoside diphosphate kinase	Interproscan
IPR006602 all species →	Domain	DM10 domain	Interproscan
IPR001841 all species →	Domain	Zinc finger, RING-type	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43109 all species →	NUCLEOSIDE DIPHOSPHATE KINASE 7	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004550 all species →	Molecular Function	nucleoside diphosphate kinase activity	Interproscan
GO:0006183 all species →	Biological Process	GTP biosynthetic process	Interproscan
GO:0006228 all species →	Biological Process	UTP biosynthetic process	Interproscan
GO:0006241 all species →	Biological Process	CTP biosynthetic process	Interproscan
GO:0005813 all species →	Cellular Component	centrosome	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_031284-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_031284-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

141.5Max TPM

50.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	30.93	46.97
polyp at pH7 6	18	18	33.71	53.64
coral polyp · control treatment	16	16	67.61	141.49
coral polyp · oil and dispersant treatment	16	16	77.16	120.71
coral polyp · oil treatment	16	16	51.94	94.94
coral polyp · dispersant treatment	16	16	62.38	111.06
Polyp	10	10	24.52	36.89

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.97
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.55
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.46
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.23
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.51
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.71
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.40
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.04
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.11
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.06
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.21
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.63
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.53
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.30
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.28
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.52
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.29
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.89
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	53.64
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.70
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.25
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.30
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.48
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.97
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.63
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.93
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.07
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.12
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.56
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.14
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.31
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.39
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.79
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.88
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.72
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.86
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	141.49
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	122.81
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	81.90
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	75.44
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	74.50
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	74.20
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	68.22
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	61.62
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	56.66
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.54
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.47
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.11
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	52.49
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.55
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.22
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.58
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	120.71
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	105.73
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	102.97
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	100.98
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	92.65
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	91.86
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	90.17
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	84.94
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	76.20
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	71.19
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	68.53
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	59.31
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	50.50
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	50.01
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.50
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.31
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	94.94
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	66.35
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	65.98
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	65.22
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.78
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	59.49
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	58.92
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.37
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	56.75
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	54.45
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.31
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.74
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.68
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.30
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.97
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.75
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	111.06
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	100.61
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	95.02
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	94.85
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	81.31
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	65.23
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	62.69
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	61.56
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	53.89
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	53.44
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	51.43
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	49.59
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	47.26
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.97
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.89
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.22
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	36.89
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	36.04
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	32.50
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	23.52
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	22.42
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	22.32
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	20.25
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	18.97
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	18.39
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	13.94

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.