Gene detail

Detailed information of OS493_031330-T1 in Lophelia pertusa

Genomic Location: scaffold_214:345874...357145
NR annotation: KAJ7370594.1, hypothetical protein OS493_031330 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_031330-T1

ATGTGCGGAGATCCTTATCCAGTGGAGCTGATTCTTGGGCCGCTGCTTCATCATCAGAACTGTTGGCGAAGTTCCACCAGTCCAGATACCATCATCTTGGAGACTTACCTTGGATTTGATAAGAGACGAGTGCAGATTACTCTCACCTCTTACCACAGAGCGTACAGTCTTAATTACCAAATGTACCATGGCTACATTCTGGTTTATTCAGCGATACGAAAAGCTTCATTAGGAACCCTCAGTGGCTTCTCAGGATTCATCCCTCAGGTCCCTATTCAGGTCCTGGCAGTAACAGGCAGCGCATCTGGGGCCAGTGTTGTATTTCACAGCCATGTAGCAGCTTCATTATTGGCTGATGGCACTAACCTGGCCAGTAAACTGTTTGCAAAATTCCAAACTACCTCTTCACAGTTTCAGCATCAAGCCGGCGCGTTCGCTGCGTTTTTCAACCAAGTTTGGGAGAAGAAAGTAGACAGCGAGATAGCATACGCGAAATTTCAGGCCCAACAAAAGCTGCGACCCTCCACCAGAACAAAGCACGACCCTCTACCAGAACCGCCAAGCATGAGACAAACGCACAGCGAAGACGAATTTAGAGGACGAAGCCTCAGCGACAGTCAGCAGCCTGTCTCTCCGAAATCGGCCAACCGGCGTTCCGAAGGAACATTGGATGATTCCGAAATCAATCCATACGCTGTGTTTAGTTCCGTCAAGAAGCCGGTAGACGCTGCCAAAATCAGCCAGGCTAGAGACTCGAGGGGAAGTGGCGACCTCCAACCGTACGCCACTTCGACGCCGAATGCGCTGTTTTTAAGCTTAAAGAAGGGCGAGGGTGCCCCTGGGGGTCATCCCCCGAGAGGTACACCCCCGAGCAATGATGTGTGGCAGAAGAGAGAGAGCAAGACGGAGGAGTTGTACGCTCAAGTGGACCTCTCCCGGAAGCGCTCCTTCAGGAAGTCCAAAGATCTAACCATGAATGACAGCGAGGTCAACTTGATTGAGAACACTCTCTACGCGAACAACAACCTGGTGCAGTCGCAAAAATCGGCCCGAGAGACCCCTCCTACGGCGCGCGAAGCCCCACCACCCCTCCCCAACAGGAATTCGCAAAAATCGGCCCGAGAGATCCCTCCTACGGCGCACGAAGCCCCACCACCCCTCCCCAACAGGAATTACAACTTGAGCGAGGACTTCCCTCCGGCTAACTCCAGAACGGACACGTTGAGGAGCATCGACGATGAGGGCTATAACACGTTCAAGAATAATGACCGCAAGGAAGAGAACCCCTACGCCGCTGTAGCCGATGTACAACCCAGGCCTCCGTCCATCTCGGTGGGGGATCCGTATTTTTTGCGAGTCAGTGAGAAGATCGACTTCTTTAATAACAAAGTAGTCATGCCGAGGAATGATGTGTGGGTAAAGATGAACGCTCGGCCAGAGGAGATCCATTCGTCCGTGCCTAGTGACTTACACAGGAAGGGATCAGATGTGGAGGCACCGCTAGCTCAACAGGAGGATGTTAGCGACCCGGAATACGCGCAGGTGCAAGACGCTTTGAAAAAAGACGCTTTGAAGAAGCGGCCCACTATTTACGCTGTAGCTGTTGTGGAAGAGCCCAGTGCTTCAGACAAGAAACCCAAACAGCACCCAAAAATCACATCTAAAGGTTCATTGAGGCTGGCGCACTCCGCTGAAGACGTCAGTACATTGGAGAGGAGAATATCCAGGCGAGTAATCGGAAGACGTGAAGATAGAGGGAATAGCATCACTTCCGATCAGGGGACTGGGGACGAGGCTACTCTGCCTCGAACTGAAGAACGCCCAGCTAAGAAGAAGAGCGGCATCAGGCGATCCCGCAGCACCCAGCGAAGCAGCAGCCAGTCCGCCACACCTAACGTGCCTACAGAGGTGCATAAGAAACAGCTCTTCTCTGGAAGGAGATCAGGCAAGAAGGAACCAAGGAAGGGTGGGACGATGTCTTCAAGTCAGGAGGATGAGTCATCTTGGGGGAGCAGCATGGATACAAGGGGCAAGCGGCCAGGATTAGCCAGGCCCACTCATTTGCTTCTACCTCAAAAACGACAATCAGATCCTGGCACAGAAGAGGAAACGGAGGATGACCCTGGTTCACCCGGACACAAACCAAGAAAATCGGAATGCAAGTGGAGGGAAATTTACAGAGTCAGTGGCAACCAATCGGACATTGGCCTCATCGAGCAGAAAGTGGAAGAAAATCCCGGAGTGGAGTTGGCCGAGCTGGGGGTTGGGGTCCATGCGGTGACAGGCGCATTGAAGTCCTTCCTAAAGCTTCTGCCTGAGCCCATAATCCCAGGATCCTATCTGAGCAACTTTCAAGATGCCATGATTCATGTTGATGCTAACAGCCGTTTATCTCGACTGAAGGAGCTTCTACATGATATACCACCGCATAACCTCGCTGTTGTCAAACGAATCATGTTTCATCTGTACCGTGTGGCGGAGTATTCCAAGGATAACCTGATGGAATCAAGGAACTTGTCTCTGGTTTTATTCCCAACCATCATCAGACCGGACTTCGCCCGACTGGAGATGTCTTGTCATATGTACTTTATTTTATTAATTCAAACGTGTATAGAAAAATGTGACTACCTCTTCTCCACGGATGATAATGGGGAGACTCAAGAAGAACAACGTTATGCCTCGATTCGATGA

Transcript

OS493_031330-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q13017	Rho GTPase-activating protein 5 OS=Homo sapiens OX=9606 GN=ARHGAP5 PE=1 SV=2
P97393	Rho GTPase-activating protein 5 OS=Mus musculus OX=10090 GN=Arhgap5 PE=1 SV=3
Q91YM2	Rho GTPase-activating protein 35 OS=Mus musculus OX=10090 GN=Arhgap35 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002900 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00620 all species →	RhoGAP	RhoGAP domain	Domain	Interproscan
PF19518 all species →	RhoGAP_pG1_pG2	p190RhoGAP, pG1 and pG2 domains	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000198 all species →	Domain	Rho GTPase-activating protein domain	Interproscan
IPR008936 all species →	Homologous_superfamily	Rho GTPase activation protein	Interproscan
IPR039006 all species →	Domain	Rho GTPase-activating protein, pG2 domain	Interproscan
IPR045786 all species →	Domain	Rho GTPase-activating protein, pG1 and pG2 domain	Interproscan
IPR051978 all species →	Family	Rho GTPase-activating domain-containing protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46005 all species →	RHO GTPASE-ACTIVATING PROTEIN 190	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0007165 all species →	Biological Process	signal transduction	Interproscan
GO:0005096 all species →	Molecular Function	GTPase activator activity	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0007266 all species →	Biological Process	Rho protein signal transduction	Interproscan
GO:0008361 all species →	Biological Process	regulation of cell size	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_031330-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_031330-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

139.8Max TPM

36.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	24.07	37.03
polyp at pH7 6	18	18	24.52	33.75
coral polyp · control treatment	16	16	36.20	53.61
coral polyp · oil and dispersant treatment	16	16	48.94	78.49
coral polyp · oil treatment	16	16	31.23	41.72
coral polyp · dispersant treatment	16	16	71.82	139.83
Polyp	10	10	17.42	24.84

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.03
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.03
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.32
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.73
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.68
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.00
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.83
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.07
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.02
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.53
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.10
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.53
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.85
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.74
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.53
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.50
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.46
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.32
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.75
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.75
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.71
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.87
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.46
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.24
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.92
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.72
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.97
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.41
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.62
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.22
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.64
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.10
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.15
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.98
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.65
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.22
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.61
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.04
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.21
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.10
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.51
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.65
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.44
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.83
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.73
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.65
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.17
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.20
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.99
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.85
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.87
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.33
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	78.49
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	72.20
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	60.60
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	58.97
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	57.20
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	57.03
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.69
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.33
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.75
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.69
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.86
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.48
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.67
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.73
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.07
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.20
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.72
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	39.52
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.61
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.78
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.44
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.78
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.45
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.56
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.38
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.37
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.34
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.51
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.14
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.73
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.90
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.37
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	139.83
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	107.21
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	94.58
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	92.02
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	91.81
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	88.32
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	82.43
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	77.59
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	67.76
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.46
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	59.54
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	56.67
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	50.28
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.14
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.61
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.86
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	24.84
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	22.39
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	22.15
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	21.13
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	18.11
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	15.88
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	14.51
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	11.87
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	11.82
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	11.48

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.