Gene detail

Detailed information of OS493_031342-T1 in Lophelia pertusa

Genomic Location: scaffold_214:492065...494260
NR annotation: KAJ7370606.1, hypothetical protein OS493_031342 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_031342-T1

ATGAAGTTTTACGTTCATTTTGAGGATCCTCCGGAGTTCACCATGGTTTTTAAATGGAACACTAGCGTAGAAGGAAACTTGAAGCTATTGCTGGAGAAATTTGTGGCAGCCTTTAACGCTAAACACGTAACTTTCGTCGAGTTGTCCCTCGACACCTCGACACTCGTGGACAAAAGCAAAACTACACCCTTGTCGCTTGAGCAAGACATGATCTCTGTCGTAAAAGATGGCATCGATCTGTTCGTCGTTGTGAAGCAGCACCTTGAACCAAAGGAGAGGCAATGCAAAGGTTTGGACTCGTTGATACAGCCTACTGTTTCGTCCGTTCGTATAAACCAGTTGTTTGCCGAGAAAGATAGAATGGCCAGTGCATCTGCAAACTCCTTGCTTGCAATTGAGAAGAATGAATCGAACAGCAGTGAGGATACACATTCTCGTTTCAGCCTTAAACATCTCCTGACAGAGGGTACTCTTAGAAATGCAGCGAACATTTGCGCCCGAGCGTTGATGGTGGAAGTAAATAATTCGTCTGCACTTTCCTGCCTGGCAGAAATTTACCTTGAAGCTGATCGCCCACTTGTAGCGTTGGAATACATTGAGCACGCAGTTCAAGTAAATCCAAACGATCCCGTATTGAGCTTTACCCATGGAAATTGTTTGGCTAATGTTGGAAAACTCAAAGACGCGACAAATGCCTACATGAGGTACATGGGTCATTTGGAATCCACTGCGGCTTCTAAGAGTGACATTCATGATGTCGAAGCAGCAATTGCCAATATTTGCGCCAAGGGGGGGAAGATAAGAACGGCTGTGGAGCTGTTTTCAAATGTGCTTAAACAAGATGACACTCATGTGGAGAGTCTAAAAGGCTTTGCAATTCATTCTGCAGGGACCTCTCAGGAGGACTTACATGCAGCTATATCTGTCATGTTAACAGCACTGGTACACAGTAATGGTAAGCGTGAGATTAGAAGACAGGTTGGCAAGCTGATTAGCCAGCCAGGTGGGATGGGCGTGTTTAAGTATCAGCTGCGCGAGTGCTGGGATGCAACGGATTCAATGATGTATATGGCTGACATTCTGCGTGAAGCAGGAGCCATAAAGAAAGCGTTAGAGTTGGTGAACCGTGCACGTCAACTATCGCCACTAGATCCAAGCATCTGCCTCTATCTCCTTCACACTTATGAAATGCTTAATGAACATAATAAAGCTTTCTTAGAAGCTCGTGCCTTTCTGGAGGGGAACCACTGCCTTAAGATTGGAAACATTTCTTGCTCACAGTTTGTTCCATTTCTACAGCAAGTCACAGAAGACATTTATTTGAACAATGCATCAGTAAAAGTTTTACCAATGTTTAAGAATCAAGATGTTGGTAAAGCTTTGGAATCTGAGCTTCATCAGCTTGGACTGTTATTTACTCTGGTGAAAATCTTATTTGTGAAAGGAGCGCTTAATCTAGTCGAGGCTTTATTGCCTATCCTGGAAAAAGTGCATAATGGTAGAGGGTTGCATCTCACATTGCTACGAAATGAAGCTGCATTTTTTTCATGCATCAGCCATACGATGAAAGTTCCATTTTTGCCATTGCCTCACAACCCGAAGTTCATTTATTTTGCCTCAGATAGTCATTGTATATCTCCAGCATGGAGGGTCATTGATTACTGTGGTAAACCACACATCCTCCATCCCTTGTTGGCTACAGGTGTCAAGGTTTGGCACATTAGAAAGGAAGGCTGCTTCTATCCTAAATTTGCCCTCTTGAATGCATTGAAAGAGGTGCCAAATGGTTCCACTGTCATTTTCAACATTGGAGAAATTGATTGCCGAGAAGAGCTGTTGGCAGCTGTCGACAACTGCAAGTATGACACAATTGTCGAGGCAATTGTGGGAGTTGTAGAAACTTACATTGGCTTCCTTAAAGAGCAGAAGGAACAGCGTGGTTTTGTAACTTTTGTTCATCCGATATTACCCATCTTGAAGGAAACAAGGAGTGTGGTGATACAATTCAACAAGAAACTTAAAGCAGCCGTAGAGAATTGTAGTGGACTCCACTGGCTAGAACTCATGGATGTGTTACTTGTGAAGGGAGGTTCTGAGTTTCACAGTTCGTACAAACTTGACGGGACTCATGTACATCCAAAGTATGTATCTCTTTTGGCAAAAGCCTTGGAAAAGTCCTTGAAACAAGTTGAATAA

Transcript

OS493_031342-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0012786 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_031342-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR019734 all species →	Repeat	Tetratricopeptide repeat	Interproscan
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan
IPR051012 all species →	Family	Cellulose Synthase/LPS Assembly/PSI Assembly	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45586 all species →	TPR REPEAT-CONTAINING PROTEIN PA4667	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_031342-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_031342-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

26.0Max TPM

4.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	4.26	6.86
polyp at pH7 6	18	18	4.20	6.16
coral polyp · control treatment	16	16	7.03	26.02
coral polyp · oil and dispersant treatment	16	16	4.60	13.35
coral polyp · oil treatment	16	16	5.10	7.37
coral polyp · dispersant treatment	16	16	2.44	6.39
Polyp	10	10	3.06	6.26

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.86
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.03
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.53
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.30
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.22
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.65
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.32
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.03
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.00
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.87
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.87
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.85
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.77
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.69
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.62
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.31
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.69
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.00
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.16
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.81
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.68
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.32
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.15
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.93
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.93
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.73
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.71
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.68
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.45
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.41
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.09
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.18
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.97
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.29
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.48
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.66
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.02
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.17
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.55
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.16
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.73
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.64
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.72
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.93
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.67
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.41
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.85
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.54
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.87
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.01
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.68
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.48
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.35
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.96
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.69
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.59
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.58
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.47
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.44
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.33
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.25
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.68
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.62
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.38
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.98
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.78
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.21
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.25
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.37
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.81
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.75
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.51
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.46
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.60
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.52
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.25
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.19
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.00
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.96
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.71
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.35
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.02
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.92
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.18
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.39
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.00
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.80
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.13
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.90
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.74
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.54
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.18
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.91
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.79
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.51
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.22
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.10
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.94
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.73
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.12
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.26
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.39
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.26
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.17
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.90
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.51
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.50
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.19
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.68
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.76

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.