Gene detail

Detailed information of OS493_031349-T1 in Lophelia pertusa

Genomic Location: scaffold_214:549454...574006
NR annotation: KAJ7370613.1, hypothetical protein OS493_031349 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_031349-T1

ATGGAGTGGAACTTTCTCTCCGGAGCTGGAGCTGTATTTCTTAGCTACTATTCTTTAAATTTTGTTCTGCAAATTCTTCATGGAATAAGAGCGTTTGTTCTTCCATCCCTTGGCATAAAAAGGAATTTGAAGAAGTTAGGCAAATGGGCAGTTATCACGGGCTGTACAGATGGAATAGGAAAAGCTTACACCCATGAGCTTGCAAGGCAAGGATTCAAGTTAGTCCTCATCAGTCGTACCCAGGAAAAGTTAGAATCTCTGGCAGCAGAACTGAAGGAAGCATATGGCACAGAAACTAAGATCATTGTAATGGACTTCACTGGGGGAGCTGAGATCTATGATGGCTTAGGAGAAAAACTTGCTGGTCTTGATATTGGTATATTAGTCAATAATGTTGGAGTCTCCCATTACCCAGAGTTTTTTGCCAATATGAAGCAGGAGGATGCGTGGAAGATGATAAATGTCAATGCTCTTTCAGTGACCATGATGACTCATACGATCCTCCCTGAGATGGCTGCAAGAGGAAGAAGCCTTATTGTAAATGTTGCCTCTGCAGCAGGCTTGACTCCCACTCCACTGCTGTCAATGTACTCAGGAACTAAGGTGTTTGTAGATTTCTTCAGTAGATGTCTCAATGCTGAGTATTCATCAAAGGGAGTCACAGTTCAGTGTGTCTTACCTTATTATGTGGCCACTAAGATGAGCAGAATCAGGAATCCAAACATCTTTGCTCCTGGCCCAACCACCTATGTCCGTCAGGCCCTGGGAACAGTTGGTGTGGAGTCCAGGACTATGGATGTTGGAGCCACGCTCTTCAGGCGTTCAAGTTTGTTTCCACTTCTCCTGATACTGCTGGTAATAGTGCACTCATCTCTGTGGGCCACTGTTGATGGGACCTTATCAAGCAGTGATATCCAAGTTACAAACCTCAAACTTCAACCATCAAGGCCAGACAATGTTTACTTTTCCTTGCGCGGCTCAACATTTGTTCTAAACTGCACCACTGTAGTGAGTAATGTGCAGGCTTTTAATTTGACATGGCAACACGATGGTGAACGTTATTTCAGTGAAGCACAACAAGTTGACAGTTCAACAGTACAACTGAAATTATCCAATACAACAACAACAACGGATAATGGCGTTTATTGGTGTGGTCCGTTATTTATTAGCAATAAATCACAAGGAGTCAACATATCTCTTATAGTGGCAGACCAAGATTATAACAACAAAACAGAGTTTACCCTGCTCAAAGCATTGGAAGCATTTATGGAGTATTATGTCTACCTAATGGTCAGATTTGTTAATGGAAATGAAGTGAGTGCTCATAGTGAAGTGTTAGGACCACGCATTATCAAAACACCACCAGGAGACCCAGGTACTCCACCCAAGGTGATAAGGGTTCAGTCTGTGAGATTTCCTGGTAATGCTGCATTGAGAAATGTTACAGTGGATTGGGAGTTGGCAGACACTTTATCCTGGCATGGCACTCCAGATAAATACATTGTTAATTGCAATCACCATCGCCGTAGCCTGGGTTCACTTCCAAACTGTGAATATCATGTGGATGCGATGACAAATAGAACTGTTTTGCAAGGACTGAACTCTGCAGACAGATACAATGTGTACATAACGATGTGCAATAAACAGAAAGGATGTAGTGTGCATGGTGAATCATATTTAATCAAGGAGCTAGAAGATAACACGACACTGTCAAACAATGGAGGACAACTGAGCAGCAAACAGATTGCTTTCATTACAGTTTCAGTGGTGGTTGGATGTATAACAGCTCTGTGGTGTAGTTTAGAGCTCTGTGAGAAAGATTCTGCGGTAGACTTGAGTATCTCTTGCAAGCCTCCTGCCATACATGGCTATGAATATGTCGATCATGTTGAACAAAATGACTATGATCGACTTTTTTGGACGAAGAGCAGGTGTGACTACAAATCATGGAAGGTGCCAAATGCCCAAGTGGAGCTCGTCGCAGGAATCAACGAATTAAACGACGTCTCAGACAGATTAGTGAATGTTTTGCAACAAGGTTGA

Transcript

OS493_031349-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6QA33	Very-long-chain 3-oxoacyl-CoA reductase-B OS=Danio rerio OX=7955 GN=hsd17b12b PE=2 SV=2
O57314	Very-long-chain 3-oxoacyl-CoA reductase OS=Anas platyrhynchos OX=8839 GN=HSD17B12 PE=2 SV=1
Q5XG41	Very-long-chain 3-oxoacyl-CoA reductase-A OS=Xenopus laevis OX=8355 GN=hsd17b12-a PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001257 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00106 all species →	adh_short	short chain dehydrogenase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR007110 all species →	Domain	Immunoglobulin-like domain	Interproscan
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR036291 all species →	Homologous_superfamily	NAD(P)-binding domain superfamily	Interproscan
IPR036179 all species →	Homologous_superfamily	Immunoglobulin-like domain superfamily	Interproscan
IPR036116 all species →	Homologous_superfamily	Fibronectin type III superfamily	Interproscan
IPR002347 all species →	Family	Short-chain dehydrogenase/reductase SDR	Interproscan
IPR051019 all species →	Family	VLCFA Elongation and Steroid Dehydrogenase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR43899 all species →	RH59310P	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005783 all species →	Cellular Component	endoplasmic reticulum	Interproscan
GO:0016491 all species →	Molecular Function	oxidoreductase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_031349-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_031349-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

57.7Max TPM

30.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	24.24	33.72
polyp at pH7 6	18	18	24.65	36.31
coral polyp · control treatment	16	16	36.97	50.23
coral polyp · oil and dispersant treatment	16	16	42.42	57.70
coral polyp · oil treatment	16	16	29.80	47.08
coral polyp · dispersant treatment	16	16	34.37	50.70
Polyp	10	10	16.83	23.04

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.72
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.05
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.68
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.63
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.82
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.68
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.66
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.52
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.40
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.88
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.95
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.78
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.76
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.21
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.11
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.76
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.87
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.74
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.31
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.94
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.12
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.61
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.75
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.90
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.30
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.01
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.79
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.35
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.29
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.18
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.00
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.70
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.72
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.63
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.44
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.61
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.23
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.07
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.80
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.81
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.83
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.83
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.88
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	40.19
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.20
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.19
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.67
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.08
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.39
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.19
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.62
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.57
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	57.70
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	57.50
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	56.34
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	53.33
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	53.02
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.33
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.89
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.26
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.05
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.00
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.39
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.99
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.37
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.97
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.64
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.88
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.08
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.96
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.96
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.41
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.49
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.25
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.20
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.83
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.77
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.74
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.54
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.38
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.19
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.45
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.81
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.77
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	50.70
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	48.12
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	45.91
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.07
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.21
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.48
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.49
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.09
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.31
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.69
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.61
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.30
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.84
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.82
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.68
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.69
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	23.04
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	22.19
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	21.96
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	19.37
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	17.38
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	16.61
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	14.12
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	13.43
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	12.53
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.63

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.