Gene detail

Detailed information of OS493_031364-T1 in Lophelia pertusa

Genomic Location: scaffold_215:386229...411513
NR annotation: KAJ7353917.1, hypothetical protein OS493_031364 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_031364-T1

ATGGCTTTGAAATCTTCTTACTTGCTGTTTTATCCTAAGCAACCATACTTTAGCCAAGCTTCTTGGAAAGGAGCGATTGAGCCGAGATTTAGTGATGGTGGTGATGAGGAGATGAAGGATGATATCGACTCTGTGCGTGGTTTGTTGGACAGACTGAAAGATGAAAAGGAGAGAGAACTTCTTAAAGAGACTTCCTCAAGTTCTGTTCAAGAAAACAACAACGACGACAACTTTAGAAGTTCAGTTCAAGACACAAAGCAGGATGACGTGATTGGTGAACTTCAAAAGAAGTCATCATCTCTTGTGATGAATCTGAAGTCAGTCGTCAAAACAAAGGGGTCGTCAACGAAGACCGTTATCTCCAGCCAAAGCGATGCGACTCTGCAGAATGACGGAGATACTTCCAACAAAGGAATATCACAGAAGAGAAAACAGGATACATTCTTGGTGGAAGTACAAGAGAGGGCAGAGGTGATCAGTAAAAGTGCACGGAAAGCCCCAGAAACGCTGGTATCATCAATGGGACACAATGTAGAGGAAGATCCAGATACAGAGGAGTTCTTGAAGAAGATTCGGGCAGCACCCTCCAGCACGTCAAGTGAATTGCATATGGAGGAGAGCGAGACAAGATTGTACAGAAGTAAATCTGCATCAGAGGTCGATTTGTCAGTTGTGGTGACGAATTCCTCAACACTGAACCTGGAACCTCAAAAGTCCAAAATCCCACTAGGAAGGCAAGGCTCGTTAAAAGGACGAAGGAAACCCACGGCAGCTGGCAGACGAAGAAGTCTGAAGTCAAGTTTTAATGACGAGTTTCTGGACTGGGACGATTCATTTGTTATCAGCGAAGGAGAGGAGTCAATGGACGAAGAACACAGCGTTGTATCCGGTGGAAGCTTCATCATAAAGGACCCTCCTCAGATGGGTGCAGGAGGTGAAGTGAGACCACGAACCAAGCCTAAGTCCAAAGTTAAGAGCCAGACGGTGTCTGGGATAGCTCTTCCAGGACTAGCAGAGGCGTTAAGCAAGAAAAAAGTCGCGGCAGAGGACAAGCAGCGTTCCCAGGGTAGCGCGGCCGAAATTGTCCGTGCAGCTGCCGAGGGTAAGAGGAACATGGCAGCTAAGGAGGATAGAGTGGAGAAGGAACCGGAAAAACCGGCCTGGCTGGTGGAGGCTGAGACGCGGAGGAAACTCCACGAACAGCGGAGACATATAAAAAACAAACAACAAGGAGAGAACGACAGAGATCAGGAAGTGGAGAAACCGGTACAAAACGGTCCTGTTCTTCATTCTCTGCCTCACAGACCTGAACCGTTAGCTGATAAATCTGACAGTACTGCTAGTGTAAGCATTCTTCACAATGTCATGCTACGTCCCGTGCGCAAACCAGACGCAATCGCGACGAAATCCGACGATGACAGCGATGCTGGTAGGTCGTTAAACTTTTGCCTTCGTCCTGTGTCGAAACCGCCGGATCCAGTAGAAAGCCAAGCTGAGGAAGAGAGGGAAAGTAGTCGATCCCATAACGTTGTCTTGCGTCCTATACCTAAACCAGAGCCAGTGGTGAATGATAAAACTGAGGACTTGCCTGGAAGGATTCAACCGGTTCGTTTGAAACCCATCGTTTATCCCTGCGATATAAGACCGTCGGTTTCTTCTGTCACGGATCATACCGAAGTAGCACCGATGACTAGACGAACATCTTCCGAAGTGACGACTTCATCAAGCTATCCATCTGTCAAACCGGTCACGCAATCATTTTCACACACGGTAACGTCGTCACGTGTTCATGAAAACGGTGATGCGTCAGATCAGAGCTCATGGTCAGCGGGACCAGCGAAAACCTCTCCCGAATATCACATCCTCCGTTCGCTTGCACCAATAACTTCGGATAAACCGATGATATCACGATCGGAACCGAAGGTGTCCGAAAATTCTTCGTCGCATCTGAATGGCTCGCGAGTCACAGTTTCGTCCAATTACGTGAGTGTCCCTCATAGGCATGCTCCGAAAACAAGACCGAAACCGGGCAACAGGTCCAAGACAGTGACTGTTACAGCATCCGAGGTGCCGGAACTTTCAAAAGCTAGGCGTACGAGCGTGGAGTTAATACACGCCAAAGTGGAGAGGAAACCTACTCGGCCTGCTACGTCTGCCGAGCCAGCCAGTAACGCGATGTCGCACGGGGACCTGAGGGGACCCCGGAGAGGAAGTGATTTGCGAGACAGAGCGGAGACATTTGACTTGTCTTATAGACCACATTACACTGGAGATGTGTTACCGCAGTGGAAGATTGACCTCATCGAGAAGAAGAAGAACGTTGGAACTTCACGCGAGAGAGAGACAAACAAAGATCATCCCCAACAGACGCATACTTCAAACGCGGTTATCGTTCCATCATGGAAGAGAGAACTTGCGGAGAAACGAAAACAGCGCGTTGAAGTCAATGGCCTGATACAAACGTCCAACAAAGAGAACGAACCCAAGACATCTCCTGAAGTGCCGCAGTGGAAAAAGGAATTCGCCGAGAGAAGAAAACGCCAAGAAATGTCGCCAAACCGAGTACAGCCCGATAAACACGACAGGTCTCCTGAAACTCCCGAGTGGCAGCGGAGACTGACGAACACTCGACGAACTCAACCGATCGTCGTTCCGAGAGGTCCGTCGGAAGATTCCACAGACCAGGTCCCGAGTTTCATGAAGGAGTTTGAGAAGAAAAAGAGAACCTTTCCTCGTGGTGGTGGAAACACAAGCTACGTTTTACAAGAAATCCGTCCAGACTTAGATCATTTTGGACACAGAGTGGCCACTGATATAAACTCCATGGGAAGAGAATGTGAACTACTACCACCAAAACTAGAACATTTTGATGCATGGGGCCGGAGAGTGGACAACATTCAGACTTGCCATGGATGGCAACAGTTACACGATGTGTCAGCTGAAGAAGGGCTCATATCCATTCCTTATGAAAGAAAATATGGACAGTGGAGTCGTATATATCAAGCTGCCAAACTGTTCATGTTTTCCCCTTCCTCTGGCTTGTACTCTTGTCCATTGGCGATGACTGATGGAGCTGCCAAGAGTATTGAGGTTTCAGATTTAACAGAGAAGCTTAGTGTTCTACAGGATGCGTTCAGCCATTTGACCAGCAGAGACCCCAAGGAATTCTGGACATCTGGTCAATGGATGACGGAAAGAAAAGGAGGCTCAGATGTGGCAAATGGTACAGAGACACTAGCTGTTCCTCAAGAAGATGGCACCTACAGGCTGTATGGTTATAAATGGTTCAGTTCAGCTACTGATGCAGACATGACGCTCACTCTAGCAAGAGTACAGAACCCTGATGGCTCTACAGTACCTGGAACCAAGGGACTTACCATGTTTTATCTACAAACAAGAAATGATGATGGTAAATTAAACGACATTGAAGTGCAGAGATTGAAAAATAAACTTGGTACCAGGCAGCTCCCTACTGCTGAACTTCTTCTCCATGGATCACTGGCTTATAAGATGTCAGAGGAAGGCCGTGGAGTCCCTTGTATTACAGACATGTTAGCAATAACCCGTTTTCACAATAGCGTCAGTGCTGCAGGTGTTATGAGAAGGATTATGAGTTTGGCTCAAGATTATTGCATGAGAAGATCAGTATTCGGTAAATTGCTAGTGGATCATCCTCTGCACATGCAGACACTCGCTAGAATGGAGGTGGAGACCCGTGCAGGCTTTCTACTCACAATGGAAGTTGGCCGTCTGCTCGGCAAACAAGAGTGCAACGAGGCTTCAGATGTAGAATTACAGCTCTTGAGACTTATTACACCAATTACAAAACTGTACACTGCTAAACAGTCCATGCAGGTCACCTCAGAAGGTCTGGAGAGTTTTGGTGGTCAGGATACATAG

Transcript

OS493_031364-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9XWZ2	Acyl-CoA dehydrogenase family member 11 OS=Caenorhabditis elegans OX=6239 GN=acdh-11 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002841 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02770 all species →	Acyl-CoA_dh_M	Acyl-CoA dehydrogenase, middle domain	Domain	Interproscan
PF00441 all species →	Acyl-CoA_dh_1	Acyl-CoA dehydrogenase, C-terminal domain	Domain	Interproscan
PF18158 all species →	AidB_N	Adaptive response protein AidB N-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006091 all species →	Domain	Acyl-CoA oxidase/dehydrogenase, middle domain	Interproscan
IPR009100 all species →	Homologous_superfamily	Acyl-CoA dehydrogenase/oxidase, N-terminal and middle domain superfamily	Interproscan
IPR052904 all species →	Family	Acyl-CoA dehydrogenase-like protein	Interproscan
IPR009075 all species →	Domain	Acyl-CoA dehydrogenase/oxidase, C-terminal	Interproscan
IPR036250 all species →	Homologous_superfamily	Acyl-CoA dehydrogenase-like, C-terminal	Interproscan
IPR041504 all species →	Domain	Adaptive response protein AidB, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR42707 all species →	ACYL-COA DEHYDROGENASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016627 all species →	Molecular Function	oxidoreductase activity, acting on the CH-CH group of donors	Interproscan
GO:0003995 all species →	Molecular Function	acyl-CoA dehydrogenase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_031364-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_031364-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

47.4Max TPM

11.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	9.62	13.87
polyp at pH7 6	18	18	9.05	11.59
coral polyp · control treatment	16	16	14.46	47.39
coral polyp · oil and dispersant treatment	16	16	13.59	29.77
coral polyp · oil treatment	16	16	10.46	17.75
coral polyp · dispersant treatment	16	16	13.78	25.48
Polyp	10	10	5.47	8.69

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.87
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.61
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.25
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.68
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.04
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.03
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.57
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.44
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.97
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.90
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.77
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.76
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.60
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.50
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.36
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.60
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.32
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.82
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.59
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.17
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.13
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.46
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.07
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.71
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.71
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.38
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.25
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.19
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.79
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.74
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.46
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.17
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.72
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.38
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.28
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.78
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.39
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.51
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.88
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.95
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.62
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.47
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.73
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.22
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.99
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.93
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.68
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.07
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.90
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.49
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.90
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.67
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.77
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.22
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.63
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.75
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.37
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.68
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.83
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.00
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.89
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.76
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.13
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.74
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.46
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.64
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.44
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.20
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.75
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.04
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.31
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.56
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.34
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.02
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.89
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.12
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.02
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.70
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.60
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.31
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.04
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.07
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.30
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.34
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.48
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.63
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.71
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.13
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.33
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.36
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.24
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.43
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.79
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.55
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.61
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.76
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.17
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.14
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.05
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.14
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.69
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	7.93
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.35
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.84
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.20
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.12
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.02
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.72
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.08
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.75

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.