Gene detail

Detailed information of OS493_031387-T1 in Lophelia pertusa

Genomic Location: scaffold_216:299815...307118
NR annotation: KAJ7323464.1, hypothetical protein OS493_031387 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_031387-T1

ATGTCTGACGTCGAAGAAGTTCAGCAAATGGAAGAAGAGACCGAAGCGGAGTCATTCGCCTTCCAAGCCGAGATCGCCCAGTTGATGAGTTTGATCATCAACACGTTCTACTCGAACAAGGAAATATTCTTGCGAGAACTCATCTCGAACTCCTCTGATGCTCTCGACAAAATTCGCTACGAGAGTTTGACGGACCCGACGAAGCTTGACAGTTGTAAGGACCTCAAGATCGAGATTATTCCCAACAAAGATGACAATACCTTGACGCTCATCGACACTGGTATTGGTATGACCAAGGCAGACCTCGTCAACAACTTGGGAACCATCGCCAAGAGTGGAACGAAGGCTTTTATGGAGGCATTGCAGGCTGGCGCTGACATCTCTATGATTGGTCAGTTTGGTGTGGGTTTCTACTCGGCCTATTTGATTGCAGACAAGGTTGAAGTGTACTCCAAGCACAATGACGATGAGCAGTACCTCTGGGAATCTGCGGCAGGTGGCTCCTTCACTGTTCGCCGTCTTACCCAGGAAGTGTTGCCCCGAGGAACAAAAGTCATTCTTCACCTCAAAGAGGATCAATATGAATATCTGGAAGAGAAGCGAGTCAAGGAGATTGTGCAAAAAGAGCGCGACAAGGAGGTGAGTGATGATGAGGACGAGGAAGAAGAAGAGAAGAAAGAAAAAGATGAAGAAAATGAGAAAAAGGATGATGAAGAAGAAGGCGACAAGCCTAAGATAGAAGACCTTGATGAAGAAGATGAAGAGAAAAAAGAGACGGAAAAAAAGAAAAAGACGATCAAGGAAAAGTACACGGACATGGAGGAGCTCAACAAGACCAAACCACTTTGGATGCGCAACACTGATGAAATCACATCAGAGGAATATGGAGAGTTCTACAAGAGCCTGTCTAACGACTGGGAGGAGCACATGGCTGTCAAGCACTTTTCAGTTGAAGGACAGTTGGAGTTCCGTGCTCTTCTGTTTCTTCCACGGCGGGCACCCTTTGATCTGTTTGAGAACAGGAAAAAGCGCAACAACATCAAGCTGTACGTGCGTCGTGTGTTCATCATGGACAATTGCGAGGATATCATTCCAGAGTACCTGAACTTTATTAAGGGTGTTGTGGATTCTGAAGATCTGCCGTTGAACATTTCTCGTGAAATGCTACAGCAGAACAAAATCTTGAAGGTGATCAGGAAGAACATTGTCAAGAAATGTATGGAGCTGTTCGCTGAAGTGGCGGAAGACAAGGACAACTACAAGAAATTTTACGAGCATTTTGGCAAGAACATCAAGCTCGGTATCCATGAAGACAGCGTCAACCGAACCAAGCTGGCCGATCTTCTGAGATATCACTCCTCGACCTCTGGGGACGAGATGACATCGCTAAAGGATTACGTTACACGAATGAAGGAGAACCAGAAAGACATCTACTACATTACCGGCGAGAACAAAGATCAGGTCGCACACTCTGCTTTTGTGGAACGAGTCAAGAGCCGTGGTTTTGAAGTATTGTACATGACGGAACCCATCGATGAGTATGCCGTGCAGCAGCTGAAGGAATACGATGGAAAGAAACTCGTCAGTGTCACCAAGGAAGGACTTGAGCTGCCTGAGGACGATGAAGACAAAAAGAAGTGGGAGGAAAAGAAGGCCAAATTTGAGCCCCTCTGCAAGACGATCAAGGAAATCCTGGACAAGAGGGTTGAGAAGGTGGTCGTGTCATCTCGCCTGGTATCGTCCCCCTGCTGTATCGTGACCAGTCAGTTTGGATGGACTGCGAACATGGAGAGAATCATGAAAGCACAGGCTCTGCGCGACAACAGCACTCTGGGATACATGGCAGCGAAGAAACACCTTGAGGTGAATCCCGACCACTCGATTGTCGAGACCTTGAAACAGAAGGTGGAGACCGACAAGAACGACAAGTCCGTGAAAGATCTTTGCATGTTGCTGTATGAAACCTCTCTGTTGTCGTCTGGTTTTACCTTGGATGACCCTCAGGTTCACGCCAGCCGTATCTACAGGATGATCAGTTTGGGACTGGAATTGATGAAGAAATGGAAGGTTTGTAAAAGTGATTTTGTGTTATCAAAGCCACTGCTTGGCAATCAGCTCTGA

Transcript

OS493_031387-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O57521	Heat shock protein HSP 90-beta OS=Danio rerio OX=7955 GN=hsp90ab1 PE=1 SV=2
Q6AZV1	Heat shock cognate protein HSP 90-beta OS=Xenopus laevis OX=8355 GN=hsp90ab1 PE=2 SV=1
Q76LV1	Heat shock protein HSP 90-beta OS=Bos taurus OX=9913 GN=HSP90AB1 PE=2 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001833 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13589 all species →	HATPase_c_3	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase	Domain	Interproscan
PF00183 all species →	HSP90	Hsp90 protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR020575 all species →	Domain	Heat shock protein Hsp90, N-terminal	Interproscan
IPR037196 all species →	Homologous_superfamily	HSP90, C-terminal domain	Interproscan
IPR036890 all species →	Homologous_superfamily	Histidine kinase/HSP90-like ATPase superfamily	Interproscan
IPR001404 all species →	Family	Heat shock protein Hsp90 family	Interproscan
IPR020568 all species →	Homologous_superfamily	Ribosomal protein uS5 domain 2-type superfamily	Interproscan
IPR019805 all species →	Conserved_site	Heat shock protein Hsp90, conserved site	Interproscan
IPR003594 all species →	Domain	Histidine kinase/HSP90-like ATPase	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11528 all species →	HEAT SHOCK PROTEIN 90 FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0006457 all species →	Biological Process	protein folding	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0032991 all species →	Cellular Component	protein-containing complex	Interproscan
GO:0034605 all species →	Biological Process	cellular response to heat	Interproscan
GO:0048471 all species →	Cellular Component	perinuclear region of cytoplasm	Interproscan
GO:0050821 all species →	Biological Process	protein stabilization	Interproscan
GO:0051082 all species →	Molecular Function	unfolded protein binding	Interproscan
GO:0140662 all species →	Molecular Function	ATP-dependent protein folding chaperone	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K04079	HSP90A, htpG; molecular chaperone HtpG	-	Exosome	ko04147	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_031387-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

737.0Max TPM

183.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	87.74	152.27
polyp at pH7 6	18	18	126.07	250.07
coral polyp · control treatment	16	16	191.77	379.66
coral polyp · oil and dispersant treatment	16	16	283.47	415.16
coral polyp · oil treatment	16	16	136.34	278.08
coral polyp · dispersant treatment	16	16	346.15	736.99
Polyp	10	10	96.04	226.20

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	152.27
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	143.32
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	125.52
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	120.96
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	105.02
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	99.90
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	95.47
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	93.36
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	92.63
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	91.99
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	87.78
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	86.19
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	58.64
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	58.43
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	49.62
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.35
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.80
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.02
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	250.07
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	249.25
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	149.59
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	148.82
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	139.51
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	138.98
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	136.88
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	135.87
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	128.40
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	113.66
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	112.45
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	99.71
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	90.14
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	89.50
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	82.77
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	81.30
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	62.93
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	59.45
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	379.66
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	268.35
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	257.45
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	241.13
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	223.54
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	221.77
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	211.68
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	198.98
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	178.84
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	157.26
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	153.63
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	147.93
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	144.34
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	136.85
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	84.67
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	62.16
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	415.16
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	407.47
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	386.63
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	384.11
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	370.00
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	313.92
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	308.05
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	296.34
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	269.99
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	269.83
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	242.75
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	229.54
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	195.52
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	161.77
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	151.95
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	132.44
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	278.08
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	260.72
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	177.54
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	168.29
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	161.67
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	159.92
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	138.65
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	129.23
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	122.90
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	122.04
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	109.90
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	87.05
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	84.38
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	74.10
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	62.85
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.20
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	736.99
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	466.28
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	461.49
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	432.35
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	420.19
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	410.98
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	407.47
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	384.89
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	360.97
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	308.45
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	271.84
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	262.24
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	258.11
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	247.21
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	72.85
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.14
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	226.20
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	192.19
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	117.49
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	96.80
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	90.81
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	69.76
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	60.28
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	41.88
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	39.59
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	25.41

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.