Gene detail

Detailed information of OS493_031389-T1 in Lophelia pertusa

Genomic Location: scaffold_216:328405...356334
NR annotation: KAJ7323466.1, Poly [ADP-ribose] polymerase 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_031389-T1

ATGGCGGACGATTTGCAGTACAAGGCTGAATATGCGAAGTCAAATCGTTCTTCTTGCAAGCTCTGCAGAGATAACATCTCCAAAGACAGCCTTAGAGTAGCAAAAATGGTCCAGTCTCCTCACTTTGATGGCAAGATTCCCAATTGGTTCCACTACAGTTGTTTCTTTAGAAAGCATAAGGTGCACGCTTTTAGTGACATTGGTGGTTTTGACTCCTTGCGATGGGAAGACCAAGAGAAGGTCAAGAGCAAAGTTGGTGGGGGTGGCGGGGGAGGGGGCAAGAGATCAGAGCCTGTCGCCACAAGCAGTAGCTCAGACGACTTGCTGGTGGAATATGCCAAGTCTAATCGAAGTAAATGCAAGAACTGCAAAGATCAAATTGACAAGGGAGAACTTCGTGTGGCAAAAGTCATGGAGCCTGATGCTGAATCTAATGCGCCAGCAGGAGTCCCTATTCCATGGTGGCATCATGTAACCTGCTTTGTTGAAAGTCGTGATTCTTTGGAAGTTGAGTCTACTGTAACAGCCGAGTCATTCTCTGGATTTACTAAACTGAAGAAGGAAGATAAAGACGTGTTGAAGAGTAAATTGGGAACAGGGACAGGAAAAAAGGCTGGAAAAGGAAGCAAAAGAAAATCTCAGGCAGTGGATGAAATTGACGCAAAAAGGAAGAAGACAGCAGAAGATGATGGAGTGGAGAAACAGCTCAAGGAACAAAGCAAATTGTTATGGAAAGTAAGAGACGATCTACAGAAGAATTGTTCTTTGCCAGAGCTCAGAGAGATGCTGGAAGACAATGGACTAAGCTCACAGGGTGGAGAAAGTTCTCTCCTTGATAGATGTGCTGATGGACTGACATTTGGAAGGCTGCTTCCCTGTGAGGAATGTAAAGGGGGTCAGCTTGTATATAGGACGGAAGGTTATTGCTGCACTGGCAATTTAACAGCTTGGACCAAATGCATGTTTGTTACAAGACAGCCTAAAAGAGATGTATGGGAAATCTCTGAGGAGTTGAAAGAAGATTTAGAGTCAGACTTTCTGAAGAGCTTTAAGTTCAAGAAGAGGGAGAGGATATTCCCAAAGGCATCTGCTGCTCCTGTTGTGTCACCCAAATCAATAATCAAATCTGAGGCTGCTATGTCAATGGCTTCTCCACTTTCTGCTGCTGTACCTGGTAAGCCACTTTCCGACATGAAGTTTGCAGTGATTGGCAGACTTCAACAAAGCAAGGAGAAAATCACCACAGCAATACAGGATCTGGGAGGATCAGTAGTGGAGAAGGTTAATGCTGTTGTCGACTGCTGCATCAGTACTCAAGCTGAAATAGATAAGAAAAGCAAGAAAATGAGAGATGCGGAAAAGTATGATGTACCAGTCGTCAGCGAAGATTACTTGGAGGCTGTCAAAAGAGGCGGGGCCAAACTAATGATCACACAGCATAGCATTGCATCATGGGGATTAAGTAAAAAGGGTACCAGTGTGATGGATGGTCCCTCTCCTCCATCAGTGGCTTTACCAAAGATCAAGAAAAGTGCTTCAGTAGGAGCAGGTGAATCAGCAAAGAAAGTGAAGGTTGCAGTGAAAGGTGGAGCTGCAGTAGATCCAGAGTCAGAGATGGAAGACACATGTCATGTGCTTGAAGAGAAAGGAACTGTGTACAGTGCTACATTGGGTTTAGTGGACATTGTCAGAGGCACAAACTCTTATTACAAACTACAAATCTTACAAGCTGACAGCGGCAGCTCTTGCCATATTTTTCGATCATGGGGAAGAGTTGGAACCAACATTGGAGGATCAAAACTGGAGCGTTGTGGATCACCAAGGTCAGCCATTGAAAAATTCATGGAACTGTATGGTGAAAAAACAGGAAATAGCTGGCTGAACAGAGAGAACTTTGTCAAGCACCCAAATAAGTTTTATCCACTGGAAATTGATTATGGACAGGATGACGAGGAGCTAAAGACAACCATTGCAGCAGGAAGCAAATCCCTGCTACCTTCTCCTGTACAAGAACTTATTAAAATTATATTTGATGTTGAGTCTATGAAGAAAACGCTAGTAGAATTTGAAAATCGACTTGAAGAAAATGCCATTGGGAAAGCTAACAAGACGACAGATAGAAAGTGCTTATTCTGTACTGGGAGAAGCACAGAGAGTTTCTATACTCTGATTCCACATGACTTTGGTATGAGGAAGCCGCCATTATTGGACAACTTGGAGCTAATCCAGGCTAAAGTGGGTATGTTGGACAGCTTGCTAGATATTGAAGTGGCCTACAGTTTGTTGAAGAGTGGGGCGAGTGATCTGGCTAAAGATCCTTTAGATGTCAACTACGAAAAATTACAAACAGATTTAGAGGTTCTTTCTAAGGACAGTAAGGAATATTCTGTGATCGGTGATTACGTGAAAAACACGCATGCTGAGACGCACAAACAGTACGAACTTGAAGTCTTAGAGGTTTTTAAGGTGAATCGTCACGGCGAAAGAGATCGATTCCAACCTTTCAAAGAACTTCACAATCGCCGTTTGCTGTGGCACGGATCCCGCACTACAAATTACGCTGGCATATTATCTCAAGGGCTCAGGATCGCGCCTCCTGAGGCTCCAGTGACAGGTTATATGTTTGGAAAAGGCGTGTACTTTGCAGTAACGTGTGCCTTTCTCCTTTTCAATCTTTTGGCAGATATGGTGTCCAAGTCAGCAAACTACTGTCGCACCTCACCTACTGATAACATTGGTCTGATGATGCTGTGTGAAGTCGCTTTAGGAAATATGCATGAACTGACCTCTGCTAGTTACATATCGAAACCTCCAAAAGGAAAGCACAGTGTCAAAGGCTGTGGTATGACAGGCCCAGACCCCTCCGCGGACGTCACGCTGGAGGATGGCACGATTGTTCCAGTCGGTAAAGGAAGTACCTCGACTGCTATGAATTCCAACCTCCTCTACAATGAGTATCCTTTTATCTACAAGATCCAAATATTAATTATCTAG

Transcript

OS493_031389-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P31669	Poly [ADP-ribose] polymerase 1 (Fragment) OS=Xenopus laevis OX=8355 GN=parp1 PE=2 SV=1
P27008	Poly [ADP-ribose] polymerase 1 OS=Rattus norvegicus OX=10116 GN=Parp1 PE=1 SV=4
P26446	Poly [ADP-ribose] polymerase 1 OS=Gallus gallus OX=9031 GN=PARP1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001312 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02877 all species →	PARP_reg	Poly(ADP-ribose) polymerase, regulatory domain	Domain	Interproscan
PF05406 all species →	WGR	WGR domain	Domain	Interproscan
PF00645 all species →	zf-PARP	Poly(ADP-ribose) polymerase and DNA-Ligase Zn-finger region	Domain	Interproscan
PF08063 all species →	PADR1_Zn_ribbon	PADR1 domain, zinc ribbon fold	Domain	Interproscan
PF00533 all species →	BRCT	BRCA1 C Terminus (BRCT) domain	Family	Interproscan
PF21728 all species →	PADR1_N	PADR1, N-terminal helical domain	Domain	Interproscan
PF00644 all species →	PARP	Poly(ADP-ribose) polymerase catalytic domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004102 all species →	Domain	Poly(ADP-ribose) polymerase, regulatory domain	Interproscan
IPR001357 all species →	Domain	BRCT domain	Interproscan
IPR003034 all species →	Domain	SAP domain	Interproscan
IPR036930 all species →	Homologous_superfamily	WGR domain superfamily	Interproscan
IPR008288 all species →	Family	Poly [ADP-ribose] polymerase	Interproscan
IPR001510 all species →	Domain	Zinc finger, PARP-type	Interproscan
IPR036957 all species →	Homologous_superfamily	Zinc finger, PARP-type superfamily	Interproscan
IPR012317 all species →	Domain	Poly(ADP-ribose) polymerase, catalytic domain	Interproscan
IPR008893 all species →	Domain	WGR domain	Interproscan
IPR012982 all species →	Domain	PARP1-like, PADR1 domain, zinc ribbon fold	Interproscan
IPR049296 all species →	Domain	PARP1-like, PADR1 domain, N-terminal helical subdomain	Interproscan
IPR036616 all species →	Homologous_superfamily	Poly(ADP-ribose) polymerase, regulatory domain superfamily	Interproscan
IPR036420 all species →	Homologous_superfamily	BRCT domain superfamily	Interproscan
IPR050800 all species →	Family	ADP-ribosyltransferase diphtheria toxin-like	Interproscan
IPR038650 all species →	Homologous_superfamily	PADR1, C-terminal domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10459 all species →	DNA LIGASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003950 all species →	Molecular Function	NAD+-protein poly-ADP-ribosyltransferase activity	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan
GO:0051287 all species →	Molecular Function	NAD binding	Interproscan
GO:0005730 all species →	Cellular Component	nucleolus	Interproscan
GO:0006302 all species →	Biological Process	double-strand break repair	Interproscan
GO:0070212 all species →	Biological Process	protein poly-ADP-ribosylation	Interproscan
GO:1990404 all species →	Molecular Function	NAD+-protein ADP-ribosyltransferase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24070	PARP1; poly [ADP-ribose] polymerase 1	EC:2.4.2.30	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_031389-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

25.0Max TPM

4.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	5.90	9.51
polyp at pH7 6	18	18	6.42	11.55
coral polyp · control treatment	16	16	5.20	24.96
coral polyp · oil and dispersant treatment	16	16	3.10	15.29
coral polyp · oil treatment	16	16	3.83	7.46
coral polyp · dispersant treatment	16	16	4.56	10.79
Polyp	10	10	2.84	6.14

Per sample · hover a bar for the full sample record

Show the sample table (110 samples)

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.51
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.41
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.86
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.43
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.23
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.86
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.05
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.03
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.00
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.97
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.84
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.73
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.66
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.45
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.41
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.82
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.58
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.36
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.55
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.13
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.04
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.36
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.22
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.14
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.61
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.60
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.32
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.16
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.54
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.52
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.36
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.80
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.92
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.82
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.95
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.42
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.96
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.28
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.95
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.78
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.64
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.70
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.66
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.39
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.77
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.67
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.59
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.53
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.45
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.75
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.23
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.87
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.29
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.78
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.39
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.84
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.21
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.88
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.52
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.51
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.24
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.07
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.14
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.05
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.82
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.65
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.65
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.64
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.46
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.89
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.18
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.12
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.96
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.94
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.32
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.80
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.78
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.19
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.02
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.31
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.57
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.41
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.23
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.12
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.79
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.14
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.11
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.97
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.22
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.86
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.46
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.95
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.91
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.62
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.90
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.74
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.39
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.14
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.11
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.56
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.14
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.27
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.22
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.33
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.08
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.89
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.64
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.48
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	1.30
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.05

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.

Co-expression network

Genes whose expression across the transcriptome samples of Lophelia pertusa tracks this one. Counts are over the whole network; the network view itself draws at most 100 partners per query gene (CNIDO_NET_TOP_K), so a hub gene can show fewer edges than the number below.

Direction	Partners	Most correlated partner	PCC
Positively correlated	20	OS493_031280-T1	0.873699760870356
Negatively correlated	5	OS493_029928-T1	-0.512455425474994

Open this gene in Network Analysis → The network opens with the gene already entered and both directions selected. There you can add up to 9 more genes, switch between the positive and negative network, and export the edge list.

Single-cell expression

Whether this gene can be visualised in the single-cell atlases of Lophelia pertusa, and in which cell types it is a marker. Expression is stored per cell, so the violin plot and the cell-type means are computed in the viewer — open a dataset to see them.

No single-cell dataset has been published for this species. The atlases that do exist are listed in the Cell Atlas.

Epigenetic marks

Chromatin and DNA-methylation data covering this gene. Peak calls are listed per sample with the genomic region the peak falls in; DNA methylation is listed as sample availability only, because those tables are queried by the DNA Methylation page itself.

No epigenomic data has been deposited for this species. The assays that exist across the site are described in the Epigenomic Data module.

What you can do with this gene

Every tool below opens with this gene already entered, so you land on the analysis rather than on an empty form. Links open in a new tab.

Analysis	What it does	Status
Primer design	Design PCR / qPCR primers on this gene’s sequence with the published primer3 settings. Opens with the primers already computed.	template found	open →
BLAST	Search this gene’s sequence against the CnidoSite BLAST databases. The query is filled in and the species’ database is preselected — press Run to start.	template found	open →
Expression heatmap	Draw this gene’s expression as a heatmap across all RNA-seq samples, and compare it with the genes you add next to it.	ready	open →
Gene family / orthogroup	Look this gene up in the single-copy orthogroups built from the high-quality cnidarian genomes, and see which other species carry an orthologue.		open →
Gene set analysis	Start a gene-set enrichment analysis with this gene as the seed list. Add more genes on that page before running it.		open →