Gene detail

Detailed information of OS493_031391-T1 in Lophelia pertusa

Genomic Location: scaffold_216:362693...380100
NR annotation: KAJ7323468.1, hypothetical protein OS493_031391 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_031391-T1

ATGGAAATTGTGATCAATGGAAGCGTTGTTAAAGTGATTAGTGGTAACTGCCAGTCTCAGATGGAGAGAAAACAGGTTGATCTTCAAAGATACCTTGGAAACATCGCAAGAGTTAAACTCGTGGATTCGGGGAACAGGAGCCATATCGCTTTTGATGACCTAAGATACGGAACAACTTGTAAAGCTCTTGAACCTTGCACCGATGAACAGAGACCAATGTGTCAAACCACACCAACACAGCAACGCACGGACTATAGTTGTGCATGTGGTGGCCAGACGTTACCGAGTCTTCCCTCGTGCAACAACAACACCTGCGCCATTACCAACGGCAGTTGCAGTTTGTTTTGTAACGACACAGAAAATAACTGTCAATGCCGCCAATGCAGCTGTGTCAGCGGCTACACGTTCAACAGCAGCAGTCAATCTTGCGTTGACATTGATGAATGTCGTCAATTAAGCACACACGACTGTCAACACACGTGTATCAACACCGATGGCGGATTCCAGTGTTCCTGTTTGACCGGTTATAAACTGAACAAGGACAAGAAAACATGCAGCGCCCACAACGAATGCAGCATTAACAATGGCGGATGCAACCATACTTGTGTGAAAACTGTTGAAAGTTTTTTCTGCTTGTGTCATAGCCAGGGCTGGAAGTTGGTAGGCAAATTTACTTGTGTTGATAATGATGAGTGTCAGGCTCAAAACCCGTGTCAGCATGTATGTATAAACACTCCGGGTAGTTATGATTGTGATTGCCGTTCGGGTTACACTCTTGCAGCTGATGGAACTCATTGTCAAGATGTCAATGAGTGCTCGTCAAACAACGGAGGCTGCGAGGCAATTTGTACAAACGTTCCGGGGAGTTTCAAATGCGCGTGTGAACCTGGTTTTCAGCTGGCAAGTGATGGCAAGACGTGCGAGGATGCAGACGAATGCAGCAGCGGACAATCGGGTTGCCAACAAGTATGTGTGAACAGTCCTGGTAGGTTCAACTGCTCGTGTTTAGATGGCTATCAACTACAAGCAGACCAAACTTCATGTGTCGACGTAGACGAGTGTCAGCTTAACCAACATGACTGCCAACAGGTCTGCAACAATTTTGAAGGTGGATACAACTGTTCGTGTTTCTATGGTTACCAACTTTCTATGGATGGCAATGGCACAAATTGTACCGATGTGGACGAATGCCTGCAAGACAACGGTTATTGTTCCCAGGTGTGTGTCAATACGCGAGGGAGCCACAATTGTACTTGTAGAGATGGCTACCGAATGACGTTTGATGAGCATCATTGTAACTATAGCGTCAGCTGCAGCAGCGCTAACGAATCATGCTATGACAATTGCATGGAATGCGAAGACGTGAATGAGTGCGAAACAGACGCCAATATTTGCGATCACTCGTGCGAGAATACCGATGGAAGCTACCACTGCTCGTGTCAAGATGGATACCAGCTAACAGACGATGGGATATCTTGCAAAGACGTGGACGAGTGTCAGAAGAGTGCAGACATGCATTGCATCAGTTGCCAAAACACGCCCGGTGACTTTCACTGTACATGCGCGGAGGGATACTCGTTCAACAAAGATGACATGGCTTGTGAAGACGTGAATGAGTGCGAAACAGGCGCCGATGTTTGTAATCACACTTGCGAGAATACTGATGGCAGCTACCACTGCTCGTGTCATGACGGATACCAGCTTGCAGAGGATGGGAGATCTTGCAAAGACGTAGACGAGTGTCAGCAGAGTGCAAGCATGCAATGCATCAGTTGCCAAAACACGCCCGGTGACTTTCAATGTATATGCGCGGACGGCTATTTGTTCAACGAAGATGACACTATTTGTGAAGTGAAAAAGCTGTTGACAGAAACCCTTACAGAGGGAAAAAGAGCAATAGCGCAAGCCCCAGACGTTGCCACGGTACTCAAAGCAACAAAACATATTGTGAATAATCTGAAGCAGATGAGCAGTGAAGAGTTGACCAAGACAGCTGATGTGCTGCAAAATGTCAAGCAAAAGATTGAGAATTTCAATACCAGTAAGAGAGAAGCGGAGGAGCTGATAACGGATGTTAGCGCGATGGTCGACTCTATGATGAATAAGGACAACAAGTTGTCATGGGAACAACACAAGGAGGACAAGGGAACAACACCCATTAATGTCATCCCAAACGCCGTGGAAGGAGTAATTCCTGCAATAATTAAGTCGCTTGATAAGGAAGCAAACGAGGAGTTTCAACATAAACATATCCAAGAAATTCGAGTGGAGACAAGAAACAGACAATCCTTTCAGGGTGGAAGAATTACAACGAACTCATCAAACAGCGTAGAACTACCCGGTTCAACTGTGAGAGATAGAAATGACAACGATACTGTGGGAATCGTTGTTGCTCTTCTCAAAGGATTGCCAAATGTTTTATCCAACGCTACAAGTGGAGGAAGGTCGAAGGACCACACCTTAATTTCCACCATTACCATCGTCATAGTAACGAATGTAAACCCGGAACATCTCGCCAATCTAAAAGAACCAGTCATTCTACGCCTGGAACATTTAGAGAAAGGTCCCCGTAGGCCTCAATGCAGCTTTTTGAATGAAACAGCTCTAGCTTATTTCCCACGAGATTCTTCCAAGCACTGGTCGAGAGTAGGATGTCATAGGAATTATTCCACTGAGGAGTACACCATCTGTCATTGCTATCATCTGACAAGTTATGGTCTGATTATGGACGTGCACAACATTTATGACGAACTGAGTGACGTTCACAAGGAGGCACTCAAGTACATCTCACTGGTTGGCTGTTGTGTGTCCATTTTCTTCTGTATTTTGTCAGTGCTGGGATTCTCTCTTGCAATGAGAAAACCACGAGAGAAGAAAGCTCGACGCGAAACGTACTGTCTACATATCAATCTTGTACTTGCAATCTGTTTCTCACAAATTTGCTTCGTCATCGGAACCCTCATCATCTCAATTGATGTGCTTGCTTGCCGGATAGTTTCCATAGCAACTCATTACTTCCTTAGTGCATCTTTCTGTTGGATGTTGGCCGAGGGAATTCATATCTATAACAAGATTGTACGAGTTTTTAGCAACAAAAAGTACAACAGGGTGTTCTATATACTGGGCTGGGGGGCCCCAGTCCTTCTCGTGTCGGCTTCTACTGGAATGTCCTTCCACGAATATGGACCACATAACATCTGTTGGTTGTCAGGGAAACTGATTTGGGTTTTTGCTGCACCCGTGTTGGTAGTTATAGCCATCAACTGTTTCATCCTCCTAAGTGTTATTTATGTTTTGCTAACGAAGACCATGGTGAACGCAGGCAAAGAAAACTCTGCCAAGAAATCAAACACAAGGCGCAGTATTAAGGTGACAGTGGTGTTGCTGCCACTCCTCGGCCTCACTTGGGTGTTTGGATTTATGGCGGTTGACAAGAATACCATCTTCTTCCATTACATTTTCGCCATCGCCAACTCTTTGCAGGGAGTTTTCATATTCTTTGCGCACTGTTGGATTAACGACTCGGTTCGCGAAATTCTCCTCGAAAAACTCCCGAGCATCAGCATGAAAGGCAAATACAAAGTCAAATCGAACCAAAGCGACAACCGAAGCAGCTCCGTCTCATTAGAAACTGCCACAGCCACAGCAACAACGAATTCAGTTCGACTGGTCACCGTAAACAGGTCGCCGACAAGTTCCCGAAGATACAACGAACCGCTTCCGTTAAAACTCGTGAACCTCCAGCAAGAGTTGTCGGCGAGTCGACACGATTCGTGCGACGATAATTCTGTGAGGCTTACTAACCTGGCCAAGTTACCGCCGAAGTATGCCGACATGTATGACGTACCGGCCTCGAAGCTTTTTAGTGTGAACAAACCGCCGAAAGAAATTTTCGCCACATCTTCGTTGAACCTCGTCAGCGCCGATGATTATCCGATTACGCCGAAGGAGGCCTACGACAATCCGACGTATGCATTCTGGAAACGTCACCAGGAGTCCATCTAA

Transcript

OS493_031391-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q80T32	Adhesion G-protein coupled receptor D1 OS=Mus musculus OX=10090 GN=Adgrd1 PE=2 SV=2
O97831	Adhesion G protein-coupled receptor L1 OS=Bos taurus OX=9913 GN=ADGRL1 PE=2 SV=1
Q80TR1	Adhesion G protein-coupled receptor L1 OS=Mus musculus OX=10090 GN=Adgrl1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0009105 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12662 all species →	cEGF	Complement Clr-like EGF-like	Domain	Interproscan
PF00002 all species →	7tm_2	7 transmembrane receptor (Secretin family)	Family	Interproscan
PF14670 all species →	FXa_inhibition	Coagulation Factor Xa inhibitory site	Domain	Interproscan
PF07645 all species →	EGF_CA	Calcium-binding EGF domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000742 all species →	Domain	EGF-like domain	Interproscan
IPR000152 all species →	PTM	EGF-type aspartate/asparagine hydroxylation site	Interproscan
IPR018097 all species →	Conserved_site	EGF-like calcium-binding, conserved site	Interproscan
IPR052080 all species →	Family	von Willebrand factor C/EGF & Fibrillin	Interproscan
IPR000832 all species →	Family	GPCR, family 2, secretin-like	Interproscan
IPR026823 all species →	Domain	Complement Clr-like EGF domain	Interproscan
IPR009030 all species →	Homologous_superfamily	Growth factor receptor cysteine-rich domain superfamily	Interproscan
IPR046338 all species →	Homologous_superfamily	GAIN domain superfamily	Interproscan
IPR000203 all species →	Conserved_site	GPS motif	Interproscan
IPR017981 all species →	Domain	GPCR, family 2-like, 7TM	Interproscan
IPR001881 all species →	Domain	EGF-like calcium-binding domain	Interproscan
IPR049883 all species →	Domain	NOTCH1 EGF-like calcium-binding domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR47333 all species →	VON WILLEBRAND FACTOR C AND EGF DOMAIN-CONTAINING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005509 all species →	Molecular Function	calcium ion binding	Interproscan
GO:0004930 all species →	Molecular Function	G protein-coupled receptor activity	Interproscan
GO:0007186 all species →	Biological Process	G protein-coupled receptor signaling pathway	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0004888 all species →	Molecular Function	transmembrane signaling receptor activity	Interproscan
GO:0007166 all species →	Biological Process	cell surface receptor signaling pathway	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_031391-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_031391-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

107TPM > 0

7Conditions

7.2Max TPM

2.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	1.51	3.49
polyp at pH7 6	18	17	1.02	1.76
coral polyp · control treatment	16	16	2.34	4.10
coral polyp · oil and dispersant treatment	16	15	1.84	3.46
coral polyp · oil treatment	16	16	1.89	3.68
coral polyp · dispersant treatment	16	16	3.15	7.23
Polyp	10	9	2.35	5.31

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.49
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.79
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.90
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.86
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.79
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.63
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.59
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.53
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.46
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.38
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.33
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.23
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.22
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.95
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.81
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.80
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.78
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.68
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.76
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.60
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.52
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.26
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.21
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.19
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.17
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.16
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.12
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.02
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.98
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.94
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.93
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.91
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.54
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.53
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.47
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.10
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.55
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.07
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.01
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.71
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.63
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.61
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.42
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.37
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.23
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.18
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.94
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.89
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.17
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.83
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.74
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.46
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.77
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.75
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.40
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.99
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.96
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.95
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.91
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.77
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.72
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.71
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.51
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.50
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.34
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.65
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.68
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.19
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.17
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.10
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.10
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.04
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.96
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.91
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.86
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.76
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.69
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.69
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.56
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.37
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.36
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.79
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.23
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.66
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.57
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.84
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.44
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.36
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.18
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.80
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.64
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.48
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.37
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.34
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.80
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.69
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.65
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.39
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.31
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.93
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.06
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.28
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.05
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.68
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.15
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.77
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.30
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.