Gene detail

Detailed information of OS493_031426-T1 in Lophelia pertusa

Genomic Location: scaffold_217:69780...72546
NR annotation: KAJ7389457.1, Recq3p [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_031426-T1

ATGGCGGAACATACAGTGCGACGAGAACAGGAAATTTTCTCTCTTTCCGTGCGACCGTTTCAACAAGCGAAAGAAAGCAGTAAAACGATATGTTTTAAATGCTTTGAAGATGACGGCTTGGTAAATTTTTTCGCCGAGGGAGCTGGATTAAGTCAGCATTTTCGAACGATGCATCGTAACACTGATGTCGACATTGTGAAATGCAAGGCAGTTTTCAATGATCACCACGGCGAGGAAACGGCGAGCGTCGTTGAGCGGTTAAGCAGACTTCGATTGCAGTTGTGCACCAATGAGGCAGACAATCTTACTTATTTCGAGTATACTGTGAGGCTAGATGGGGATGCAGCTGGCACAAAAATCGTGGCGAAAACAAGGAGGGAAGCGGCAAAACTTTATGGCTTAGTTCTTCACCATCGTGGCAAACTGAGGGCTCTTGGAGACCGACCATGTGTCATTCAGGTGGAGGAAAACATCCCCAACTCGAACGGACAAAGCTATCGAGCGTGGAATGCAGGAAACAAAATTTACGTCGAGTGTTTCATTCCAAGCAGAAGGATGCTCTCAATTACCCATGGAAACACTCCCTTAACTGAACAACACTATGCATTTGCTGGGGAATACTCAACTGGTTCCAGGAACCCTCTGGAAGTGTTGCATAGTGTTTTTGGGCACACTGAGTTTAGGCCTGGTCAATGGAATTCAATTTCCAAAATTTTGTCTGGAAAAGATGTTATTGTTGTTATACCAACTGGCGGAGGGAAGACAGTGGTGTATGCATTGCCTTGCATCATGATGCCTGGATTGGCAGTTGTGATTTCTCCACTTATGATGCTCATGTGTGACCAAGTGGCAAGACTGAGAGGATGTGGCATCAACACCTGTTACTACAATACCATGTTAAGTGACAATGAGAGACAAAACATTTTGCATAATCTGAAGCAACCTAATTGCCAATACCAGTTTGTATTTATTAGTCCTGAAGCTGTAATCACAGACAGTTTACAAAGCTGCCTGGACACTTTGAGTCAGGAAAAACGACTCAAAATGTTTGTTGTAGATGAGGCACATTGCGTGGACACCTGGGAAGCCAAAGCCAAAGATCAAGTGGCCCAGATTGTCAACAGTGATTTTGATGGACTATGTGGCATAGTGTACTGTGCACGCCAGGCCGACACTGTTGAAATGGCCTTCGAGTTGAAGGAGAAAGGCATTTCTGCCACATATTACCATGCAGGAATGGAAGGGGGTGAACGCATCCGAAATGCTAACTTATGGCTTGAGGACAAAGTTAAAGTTATATGCTGCACAAATGCCTTTGGCATGGGTATTGATAAGAAGGGTGTTAGATTTGTAATTCACCTTACCCTTCCATCTTCATTAGAGGACTACATTCAGGAGTCTGGAAGAGGAGGGCGTGATGGTGATTATTGTTCCTGTGTTCTGCTTTACCGCTTTGGGGACAGGTCATTTCATCTGCGAAACATAGCCGACCTTCCGTCTAATGAAGCCAATTTGTCCCTTCTTAATTCTATCACAGATTTCTGTATGCAAACCTCACTTTGCAGACAGCAATTCATTGCCAAATATTTTGAGGAGGAGCATGGAGATGTGTGTAAATGTTGTGACATATGTCACGAAGACAATGTCCGAGAAGAAAAGGACTTTACAGTTCATGCCAAGAACGTTATTGAATGTTTGAGTCAAATCAGGGCTCTTCAACCTAAACTCAAATTGACTGATTTGGCAATGACCTTTATGGGTTCAAAGGCCAAAGCCATAACCAATCAGAGTTTCCACACAGTTCCACAGTATGGAAAGGGAAAAGAACAATTCCTAAACATCAGCAATGCAACTAAATTTATCCAGTTCTTGATTTTTAAAGGATTTATAAATGAAAACATTAGAGCCTTAGAAGAGAGGATGTCAATCACTTACTTAACCTGCGGGAATGTGGCAGACTTAGTTGACAATAGTTGCCAAGTATTTTATTCTACGTGA

Transcript

OS493_031426-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6AYJ1	ATP-dependent DNA helicase Q1 OS=Rattus norvegicus OX=10116 GN=Recql PE=1 SV=1
Q9Z129	ATP-dependent DNA helicase Q1 OS=Mus musculus OX=10090 GN=Recql PE=1 SV=2
P46063	ATP-dependent DNA helicase Q1 OS=Homo sapiens OX=9606 GN=RECQL PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000285 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF16124 all species →	RecQ_Zn_bind	RecQ zinc-binding	Domain	Interproscan
PF00270 all species →	DEAD	DEAD/DEAH box helicase	Domain	Interproscan
PF00271 all species →	Helicase_C	Helicase conserved C-terminal domain	Domain	Interproscan
PF09382 all species →	RQC	RQC domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR032284 all species →	Domain	ATP-dependent DNA helicase RecQ, zinc-binding domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR036388 all species →	Homologous_superfamily	Winged helix-like DNA-binding domain superfamily	Interproscan
IPR014001 all species →	Domain	Helicase superfamily 1/2, ATP-binding domain	Interproscan
IPR011545 all species →	Domain	DEAD/DEAH box helicase domain	Interproscan
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR036390 all species →	Homologous_superfamily	Winged helix DNA-binding domain superfamily	Interproscan
IPR018982 all species →	Domain	RQC domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13710 all species →	DNA HELICASE RECQ FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000724 all species →	Biological Process	double-strand break repair via homologous recombination	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0005694 all species →	Cellular Component	chromosome	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006268 all species →	Biological Process	DNA unwinding involved in DNA replication	Interproscan
GO:0006281 all species →	Biological Process	DNA repair	Interproscan
GO:0006310 all species →	Biological Process	DNA recombination	Interproscan
GO:0009378 all species →	Molecular Function	four-way junction helicase activity	Interproscan
GO:0032508 all species →	Biological Process	DNA duplex unwinding	Interproscan
GO:0043138 all species →	Molecular Function	3'-5' DNA helicase activity	Interproscan
GO:0003676 all species →	Molecular Function	nucleic acid binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006260 all species →	Biological Process	DNA replication	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_031426-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_031426-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

101TPM > 0

7Conditions

8.1Max TPM

0.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	0.83	2.00
polyp at pH7 6	18	16	1.09	2.71
coral polyp · control treatment	16	16	1.05	6.90
coral polyp · oil and dispersant treatment	16	16	1.37	8.09
coral polyp · oil treatment	16	16	0.73	2.01
coral polyp · dispersant treatment	16	12	0.37	1.33
Polyp	10	7	0.37	0.80

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.00
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.64
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.39
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.30
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.10
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.07
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.96
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.89
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.88
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.82
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.66
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.55
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.40
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.32
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.29
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.26
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.18
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.17
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.71
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.52
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.27
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.03
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.97
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.87
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.44
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.10
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.84
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.70
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.61
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.51
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.35
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.33
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.21
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.19
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.90
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.42
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.31
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.18
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.98
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.98
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.97
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.68
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.60
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.47
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.40
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.23
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.19
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.18
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.17
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.15
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.09
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.14
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.19
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.01
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.64
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.03
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.82
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.47
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.42
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.42
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.37
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.31
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.31
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.27
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.20
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.18
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.01
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.44
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.29
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.21
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.00
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.95
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.76
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.59
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.49
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.38
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.37
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.30
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.28
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.27
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.20
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.20
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.33
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.10
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.91
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.49
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.39
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.37
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.35
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.33
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.22
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.21
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.16
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.10
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.80
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.76
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.76
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.50
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.43
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.30
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.15
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.