Gene detail

Detailed information of OS493_031481-T1 in Lophelia pertusa

Genomic Location: scaffold_218:253729...269128
NR annotation: KAJ7382979.1, Intermediate filament tail domain-containing protein [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_031481-T1

ATGACTTCGCGAAGTTCACCGATCCTCGTCCCTCGCTACATGGAGAAAGATTATCTTCAAAGTCTCAACGATCGCTTTGCCTCGTACGTTTCTCGCGTGCGGCAAATGCGCGAACAAAGCGGTCGGATGGAGAGTGTGAATCTCGTAAACACGACCAAGATTCTAGAAGACGAGATCGTTGCTTTAAAAGGCATGTACGAGCGACAACTTGAAGAGCTCAGAAACAAACTGGAGGACATGGCTCGCGAGAGAACACAACATCAGTTGGCTGCCGCGAAGAATTCCGCCTTGGTGGCAGAGCTTCAAGACAAACTGGCTGAAGAGACAAGTGCTCGAAAAAAGACCGAAAATGCTCTAGCTGATGCGCACCGAGTCATTGCAGACAAAGAGGCTCTTTTGCAAGATGCACGAGTCACGACCACCCAACACCAGAATGCTCACATGGACACCAAACGAGACAGGGATGGTCTTCAGTCTGCACTGACGCAGACTCAGCAGGCATTAGACGTTGAAGTGGCAGCGAGAGCCGATCTGCAGACTCTAGCTAATCAGCTCAAAGAAAAGCTCAACTTTCAGCAACTGCTGCATGAAAAGGAGTTGCATGAAATGCGTTGTCGGTTGGATGAAGCTGAGAGGACCATTCTGCTGGCAGAGGAGAGGTTGCACGAGCATAACATCATTGATGAAAATTTGTCGAGCATGTTGGCTAAAGTGAAGCTGAACAGTGAAGCAGAGCTACGAAGGTTTAAAGAAGAGGCAGAGCTTTCCTATCACAATGGGATGAATCAGTTCAGAGTACAGCTGGATAATGAATCCCGAAACCTTGCATCAGCTACAGATGACAACATTCACTTGAAGGCTCACGTTGAGGCATTACACTCCAAGAACATCAACCTTGAAGCTAAGTTTGGAAGCACAAAATGCTGGCTTGATTCAATCCTGGAGATGGAACGGCAGCAGGCTTCAAACAGCATAAAGAACCTTGAGGCCAAGCTGCGAGAACTTCAAGAGGCCCTGATGGCCAAAGTGCGAGAGTTGGGCCTGGCATACAATGCTCACCTTCCTTTGGATCTTGAACTGGATTCTTTTGCTACTTTGTTGGAAGCAGAGGAAAGAAGACTAAGCCTGGCCATGGAATGCAAACTTCCTCTTACCCCAGTTCGTTCTCGTACCTGGCATGCCACCCCTACAGAAAAAATTGTTACCCCGGCATCCATCAAACGCCCAGCCACCACCCTGGGTATTATGCATCCTCCAGTAGTTACAAGCACTGCTGTGATACGGCGACCTGTGACACGACCCAAGACTACCTCAGGTACTTTAGCTGGAAGTAAAATAAAGCCTGTAGTCCAGCCAGTAACCACAGCCAGTCCATACCGTCACACCTGGTCCTACGTACCAAACTTTGTGGACTACCACAGCCCAACATCAAGTCACACAGGAAATGTTCGTATCTTGGAGGTCAATCCTGATGGAAATTATGTCAGAGTCTTCAACACATCCAGCTTCAAAGATGAAGAGGTTGGTGGGTACATGATTCAACAGAATGTTGCTGGCAGGCCTGTTACAGTCTTCCGTTTTCCTCCAAGAACTCGCCTAAAGGCTCTGTCACATGCAACTGTGTGGTCAGCGGCAAGCTTGTCCAGACATAACCCGCCATCAGACTTCCTGTGGAAAGACCAACACAAGTGGGGAACTGGACCAGAGTGTACCACAATCCTTTGCAAGCCAAATGGACAGGCTGTGGCATGGACCACTGCTGCTTATCCATTTGGTGTGCCTAATCAAATTCCCACACGGGAAACTGGACCATTCGTCTTACAAGAGAGTGGATTGGACAGGGAGCCTGTCAAGGAGAAGACCTCACCTCGCTCTCCAAGGTCCAAAGTTCCCGACCCCGTACCAAGAGAGATAGAAGGCAAACCTTTCTCTAATTCCCCAACTGACCCTCTTCACCCGCACACTGTTCAACCCAGGACCAAGACTGGCGGCCATGATGCCATGAGCATGCACCCTCAGGCGAGATCGCAGTCTGAAAGGCCGGATCCTTCTGGTGCTAGTCGGACTGGAGGGGCTCCTCTGAGAAGGTTTACAGGGACGTCTTTGCCGAATAGCAAGAGCTCAATTCCAAAGAATGGCCAGGGAGGATCCATCCGTGTTTTGCCAGCAACAGACTTCAGCTCACCGTCACAGAAACATCAAGACAGACTGACCCAAATAAACAGTCAACAGACGGTCGAATTCGCTCCACCGATGCCTCGACCGTATGTGATAGCGCACACATGGTAA

Transcript

OS493_031481-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q4R899	Lamin tail domain-containing protein 1 OS=Macaca fascicularis OX=9541 GN=LMNTD1 PE=2 SV=1
Q8N9Z9	Lamin tail domain-containing protein 1 OS=Homo sapiens OX=9606 GN=LMNTD1 PE=1 SV=2
Q9D4C1	Lamin tail domain-containing protein 1 OS=Mus musculus OX=10090 GN=Lmntd1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002850 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00932 all species →	LTD	Lamin Tail Domain	Domain	Interproscan
PF00038 all species →	Filament	Intermediate filament protein	Coiled-coil	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR042840 all species →	Family	Lamin tail domain-containing protein 1	Interproscan
IPR001322 all species →	Domain	Lamin tail domain	Interproscan
IPR039008 all species →	Domain	Intermediate filament, rod domain	Interproscan
IPR036415 all species →	Homologous_superfamily	Lamin tail domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR47012 all species →	LAMIN TAIL DOMAIN-CONTAINING PROTEIN 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005635 all species →	Cellular Component	nuclear envelope	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_031481-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_031481-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

88.1Max TPM

16.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	13.99	29.48
polyp at pH7 6	18	18	11.73	18.00
coral polyp · control treatment	16	16	23.66	88.15
coral polyp · oil and dispersant treatment	16	16	18.13	34.52
coral polyp · oil treatment	16	16	19.38	36.19
coral polyp · dispersant treatment	16	16	16.35	34.79
Polyp	10	10	12.94	21.81

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.48
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.99
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.80
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.29
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.87
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.58
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.53
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.40
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.43
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.36
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.78
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.05
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.69
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.20
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.45
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.34
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.18
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.37
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.21
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.87
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.64
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.42
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.82
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.09
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.54
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.42
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.33
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.90
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.63
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.53
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.92
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.10
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.39
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.27
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.14
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	88.15
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.28
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.81
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.43
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.42
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.69
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.42
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.61
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.16
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.11
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.36
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.26
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.29
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.88
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.36
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.40
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	34.52
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.59
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.17
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.90
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.85
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.62
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.15
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.48
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.78
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.90
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.04
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.38
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.21
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.05
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.87
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.52
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.19
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.31
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.08
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.82
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.78
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.22
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.48
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.18
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.97
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.11
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.61
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.02
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.07
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.93
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.88
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.43
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.79
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.98
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.76
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.71
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.79
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.50
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.24
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.83
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.67
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.64
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.35
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.13
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.71
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.10
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.53
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.89
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	21.81
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	18.12
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	18.03
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	13.65
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	11.66
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	11.44
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	9.01
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	9.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	8.60
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	8.08

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.