Gene detail

Detailed information of OS493_031725-T1 in Lophelia pertusa

Genomic Location: scaffold_224:343618...365753
NR annotation: KAJ7382949.1, hypothetical protein OS493_031725 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_031725-T1

ATGGATCGACCTAGCATTGACGCAGGAAATACAGAGGTTGTGGAGTTTGAGAGAAGGAGGATGGAATCGTTAGGAGAGGAGACTGAAGCAGGCGAAGAAGCTCAAAGTATCATCAGTGATAGGAGCGGCTATTTACAAATTCCTTACGGTTTTCATAGCAGAGGATCCTATAAACATGCTTCAAAGAACTGTGAGATTGTTGGAGTGACACACAATTCCCGATTCAGACAGTTTGTGTTTCTTGATTCACGGGGGATCACAAGTTGGTCATATGAAAGTGTTTACAACACAGTTACAAGGCATTTCAACTATCCATCATACCAGTTTAACGTTCTGCGACTCATCATATTTTCAAGAAAGTTCAATGTATATTTTGCATTGTCCAAAGAGTATGTATTAAAGGTTTTCAATCTGAACTTTCATGAGGTATTTTCAGTGTCAGCTGAAATGCATTCAGTACTGTGTATGGTGTTTAATCACGGTAAAGACGAGCTCATAACTGGAGGAACGGGTGGCATGAAGTTCTGGACATTTGGAGAAATCGAGAAAGACAGACAGAAGGCCTGGGAGAGAGACTCACGACCAATGGCCAAACTATGGCTTAGTGTTAAGGTGTTTCTATGTCTTATAACTTTATTAGTCATTTGTGATACATTATACCTTAGACCGCCTGGCAGGGGTCTTCCATATAAAAGTAACAGAGGGCATCCTATCCTGACATGGGGGAGCTGGGTCAAACAGGTTGAACTGGATGAGCCCATGCAACGTCTCTATTGTTTGTCTGAACGCAATGTGGTGGCATATGACATGGAAGGAAATCTGCTCTTCCAGATACTAGATGCTCACAGAGGGCCTGTGACTGGATGTGTTTACTCCAAAGCTTGTAATTTTATTGTCACTGTAGGAACTGACTGCGATGTGAATGTGTGGAGCAGATCAAAGAGTGGAGGAAGAGTACACACATTTACTGGACATTCTAAGGCCATAACAAAGATAATGCTTCACCCAGAAAATTCAGCCCTGGTGCTAACAGCAGCTATGGACGGCATTGTAAAAGTGAACTCACTTGATTTCATGGAGGAGCTCTACAGCCTACCTGTATTTTCAGAGGGAATTTACTGGATGAATGTTGTCTCGTCAAAGCTTATTTACTGCTGCTCAAACCGAGTTATTGAAGTGTTCAATCTCAATCATTTGTGTGACTTCTGGGCGCTGTCGCGCTGTTCAGTGACATCACTTTCACTGGTCACGTGCAGGGGAAAGTCGACGCGTGTTATGGTAGTGGGGAATGATAGCAGTGTTCGCTTGATCTCCCGGAAGCGCCAGAACCTCTCCACAGTCCTCCTCCGCCACCAATCTCGCCTCTTAAACATGGTTAAAGATGTGGCATACAACAGGGAGTTTAACATGATGTATTTGTTGATAGATGAGCAAGAGATCTGGGTCTATTATACCAGGACGAATCCAGCCACGCGGGTCGAGTCCTGGAAACTAGACTATATTGAGGACATTCATAATCAACACTCCCAGGATCCTTTGCAGAGGTCCAGAGCAAGTACATGGCTTAGTGAGGGAAACAGGATGGAAGAGTTCTCTTTCTTCACAATGTTTTGGCGAGGACTAAAGTATCATCAGCTTCAAGCTAACAAGGATGCTGTTCTCGAGCTTTACCACGACCAAGACATGAACACGCTGAACAATATTTTGCTGTGTGGGCATCGAAGTGGTTATTTACATCTCCATTCACTGTCTTTGGATAACGGTGAACTTTGTGAGGATGAAGATGCAAGAGCTACAGGCACCAAGCGTTCTCCTCCAAAGGATCATCACAGCAGTATAAACAGTGTGGACTCTAACTGCAACCTGGAAATATTCTGCAGTGTCAGTGGAGATGGCATGATTAAGATTTGGGACAGAGATAAAACCCTGCTACGTGAAATAATGATGAATGAAACATTAACAGTGGCTGCCTTCCTCAATACTCAAGGAGATATTCTCATCGGATTTAAACAGCACATCTTTATAATTCCAAACGAAAAAGGTACCCTTTCCAAACTTGCAGTTAAAAACCTCTTGGTTTATGGAAGGAAGACCTCCCCCGATCTTGAGCCACAAAATCAAGAAGAGGAGGAAGAGTCGCTCAGTTTCCTGTCGGACAGCCTTTCTCTTGCTCCGACTGAGGTCTACTGTTCCCCGTCCTCCACCCCCAGGAGACTGTCCTTGGCTAGTTCTGTAGCCATGTCGGAGCGCAGAACCAGCACTGAATTATGGGAACTTCCTGAATTCGGTAACTCGCCTGTGTCATCGCCACCGAGAACTCCACCACCAGAACCAACACCACCCTCTACCCCTCCCCCGGGAGAGGGGTCTGAGGAGGAATCGAGCGGAGGTGAAGAAAACACAGAGGAAGAATCTCAACAAGCTGGTGATCTGTCATGTGACCAGTGTGTCGATGTAACAAAAGGAGGAAAGAAAAAAGTTTCTATCGTTCCGAGTTTTCGAAGAGAAAAAGGAAGAATGGGTAACGTGACTATCGACTCCAAGTCCCTGCGGTCTGGCTATGGAGGTCCCGGATATGCTGCGCCAGTTGCTAGAAAAACGGTCGTCCAAAAACCTGAACCAAAGACGTTTAAGCCGCTAAAGCGAATCCCCCCGAGACCGCTAATGAAAAAAACCAAGAAAACAAAAGAGAAGGGCGAGGAGGAAGCCACGAAAGAAACAGACGAGAAAGATAAAGACAAGCTGGAAAATGAGACTGAAGTAACTAAAGACAAACAGGACGATGAAGCAACTAAAGAGAGCGAAGAAGATTCTTTACACAGATCTCCAAATGTCGTTAACATGCCTACAGGAGAACCCAAGCCTCTTTTCCGACAAGACACTGGTGCTGCTCGACGTGTTCCTGGGACTAGTTCCATTCCCCAGGAGCAGGAATCTACGCGGTCAACAAAGAACGAGGAGAAAGCGCCTGAGAAGGAAAAAGCAAAAGACACACGAGGACCGCAGGACACCACATCGTCTCTGTCACCGCAAAAAACCGCTGAAGGAAGCGCAACGAAGGCTCAATCTGGTGCTAAGAGTCCATCTGCTGAGACTGGAGATGAAAATGCAGCTGAGGCTCAAGATAAACAAGCTGACGGCAAAGAAGAAGGAAATGAAGAAACTGCGCAATCATCGCAAAAAGAAAAGCCACTAAAAAGCTATTCACCGGAACCCAATGAAGTGCCCCTAGTGACGTACATAGATCCTGACACAGGCGAGGTACTACAAAAGCCAGCAGATGAAGTCCCGGATGATGCTGAGATTCTTGAAGATTACGAAGATGACGATGAACTAGAAGGAATCGATGAATTTCCCTCCGCAGCAGCAGACGATTTAACATCGTCATTCCGCAACAAACGAAGCGACCGTGGACAAAAGAACGTAAGCTTTACGCCGGAACATGCCCGTGCTTCACGTCCAAATCGACAACTGCCAAATCTTCATACGTCTGGTAGAGACTCTCCAACTTTAAGATCACACAATGGCGTGGTTTTTAAGGAGGCAGTATTACCGGTGTACGATAGCAACAGGCCGGGCGACCTGTTCAGCAAAGTTTCCAAGAGCTCATCCGGGGTATCACCATTGACGATATTCGCGCTGGCGAGGAGCAGGCGGGAAAATACTGAAAAGGCGGGAAAACATAGAAGTCACTCAGCGGACGCACATTCGAGACAGAAACAGGGTTCTTCTGAGAATTCCAGTTTAAGAGCCGATGATGCGAACCTGGACGATTTTGAACTGAATGATGACGACTTTGCGCGGCTTATCGATAAGATGAGTTTACAGGAGACGCCTGGGTCCTCCAGGCCCCCTAGTGTGAGGAAACAAGGCAGCACTCTCATGAGGTGGTGCATACGAGCACTCAAGAAAACGGACCGAGATGTTCTTTTTCCACCCAAGCCAACTCGACCAAACAGTTCACCGAGTCAGCGGACTGCGGAATCAAAACCTGCGAGGAAAGACAGAGACGCGTTTAGAGGTAACACGCTGTACCTCAATACCAAGGACACTCCGAAGAGGCCGCAAACCGCTGACACCATTCGCAGTAACGCGACGAGTAATGAGGAACACTCCATGTTCCCATATAAAACACCAAGGCGGACACAGACACGTGACCATAAGAGTGCCCCACCCGTCAGAGTAAGCACGTGGAGGCACGTGTCATCAGACGAAGATGAGGATTTTATAGACGCGTACCAAGCTATGAACTCTAGTCTTGGTTTACATGAATCGGACGAGGATTACATGAAGGATTCCATTTCCCGAGCTGGAAGTGAGAGGCAAACTGACACGCGAGATCTCCCAATGTTAGACACAACTGACTACGGAGGCAATTGGCAAAACAAGGTGTTAGAAAGAGCACATCGACTAAAACAACAGCGTTTGGAGAGGCAGAAAACTGCCACAGAAAGAAGACAAGCACTTGATAGCAAACAGAAGGAGAGATGGAAAAAGTCGAGTCACTTTGAATGTGCACAAGAATCACCCTTCAAGTCTGAGAGCTCATTTGAATTCATCACACCACCCCCCACCGTAGTCCGTAATGTGACACCCACCCTCCCCTCCCACGAAACTCAAAACCGAAACAAGGAACAAGAGTTGTCAAATGAACGCCCGTACCGTCTGAGACTAAATCCTCAGTCTGGAGGCCTGGTACTGACTCCAGTGGCTAAAAGCTTGATGAACCTGAAGACATATGATCACCACGTGTCTGATGTGGCAAATGTTTTACCCAAGCCTCCTCCGTCAGCCTCGATCCCAAGCAAATGCAGTCGCTATGTGCTGGTGGCGCAGCCAGACGTTAGAGAATCTCGTGCCCAGGCCACGGCGATGGAAGAAACCCTTCTAATGCTACGTTTTCCGAAGTCACGTGCACGAAAACGTCATACGAGTGCCACTATCCCCAGGCTATACTCAAATCGAAACGCTCGCGTACAAACGAGTTACGAAATGTGA

Transcript

OS493_031725-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002409 (this species only)
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00400 all species →	WD40	WD domain, G-beta repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45532 all species →	WD REPEAT-CONTAINING PROTEIN 97	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_031725-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_031725-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

21.4Max TPM

10.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	12.25	16.07
polyp at pH7 6	18	18	11.57	21.40
coral polyp · control treatment	16	16	10.61	19.99
coral polyp · oil and dispersant treatment	16	16	6.85	12.84
coral polyp · oil treatment	16	16	12.26	17.51
coral polyp · dispersant treatment	16	16	7.35	20.94
Polyp	10	10	9.84	18.26

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.07
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.22
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.15
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.97
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.58
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.56
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.25
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.23
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.65
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.41
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.38
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.72
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.38
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.23
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.50
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.20
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.78
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.19
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.40
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.54
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.72
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.64
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.60
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.19
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.19
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.22
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.22
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.99
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.98
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.24
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.07
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.83
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.57
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.31
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.16
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.45
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.99
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.59
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.44
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.52
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.48
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.51
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.82
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.82
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.30
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.79
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.27
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.99
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.97
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.80
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.79
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.60
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.84
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.36
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.96
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.50
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.05
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.25
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.09
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.02
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.20
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.96
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.49
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.85
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.61
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.48
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.38
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.53
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.51
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.41
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.08
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.92
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.10
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.01
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.15
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.46
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.75
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.35
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.60
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.57
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.29
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.39
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.46
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.12
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.94
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.98
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.72
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.54
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.30
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.18
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.52
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.85
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.17
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.12
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.62
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.51
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.47
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.74
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.65
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.23
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	18.26
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	16.68
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	11.84
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	11.61
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	11.10
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.64
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	6.51
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.40
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.69
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.69

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.