Gene detail

Detailed information of OS493_031728-T1 in Lophelia pertusa

Genomic Location: scaffold_224:430134...439758
NR annotation: KAJ7382952.1, hypothetical protein OS493_031728 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_031728-T1

ATGAGTGCAAGAAGTGGCAGCAATACTGGACACATCGCAAATGAAGAAACGATTGTGGAAACTTCACCTGAACTCGCGAATATTGAAATGAAAAATGTGACTGACAGCGAAGCACTCCACACTGATGGTGTTAATGTCGTGGAATCAGAAACTAATGGAGAAGCAAATCCTCCTGAAAATAAGAGTTTAGAGTTGGAAGAAATAGATGATGAGGAGATAGAAGAGTTTGAAGAGATGATAGCTGATGGTTTATCGCAGTTAGGCCGTTCTGCTGACGGGACACTTCAAGTTTATCTCAATCTCTTCTTACCGGGATGTGGAGTGACAGATATCTCTTGCTTGCAAGAATACATCCACTTACAAATTGTAGTCCTTTCACATAATTCACTCACAGATTTAAGTCCACTCGGCTGCATGCCTTACTTGGTGTCACTTGATGTCTCACACAATGATCTCACCACTGTCTTAGATTTCAAGCCTCCACTTGGTTTAAGGGAAGTGATATTGTCCTACAATAAGATAGAAGCCCTGCCAGATCTCTCAGCTCATCACTGCCTCACAAGTCTAACACTGGACTGTATCTTTGGGAAGAAACATAATGGAATATCTGAAATACAGGGTTTGTCTAGCTGTTACCGGCTGTCTAACTTGAGTTTAATGAACAACAAGATTTCCAGGATAGCTAACCTGGACAACTTGCCTCTGAAGTCACTCAACCTGATAATCAATTTGTCCAGGAACAGTATTCGGAGTATGAAAGGTCTTCAGAACCACAATTTACTACAAGAAATTGACCTTGAGGAAAATCAGATAATCGATATTGCAGAGGTACGATACATCAGAGAACTGAGTTTGCTACGGAACCTGAACTTGCTTGGAAATCCAATACAGGGTATGCCGGACTACAGACTTTCCTTATTATTCAGAATACAAAGTCTGACGGAACTGGACCGCTCCAAAGTGTCCGTTGAGGAAAAGGTTGCCGCTGTGAACATGTTCAGTCCCCCCGCGGATGTGATCGCAGCACGTGATCACATGTTTCACGTGACAAAGTCGCTTCTGCAGCCGACAAGAATTCACGACAGCACCCTCCCAAGTGTGGACACACCATATCCGATGTTAATTTTGTGTGGACCGGCTGGATCTGGCAAACGATATCTGGCGCGGAGACTGTGCCAGGAGTTTCCAGACTTCTTTGGCTTTGGCATCTGTCACACGACAAGAACGCCTCGTAAAAAGGAAGAAAACCCTGAAGACTACTGTTTTGTGACTCAAGAGGAATTTGAACAGGGAGTTGTGATGGGTAAATTCTTGCAGACCTGCCAGCTCTCGGGGAACTGGTACGGTATCACCAGAGAGGCCCTGGAGAATGTGGCCCGCGAGGGTCTCGCTGCGGTGTTCCACATGGACCTAGAGGGAGTGTTGAGTTTTAAGAACACTTATTTTGAACCCAGATATGTTTTGGTAGTTCCCGTATCAAGAGAGGTTCATGAGGCTCGTCTGCGTGAGACTGGTGACTATGCAGAGCCTGTGTTACTACAGTCATTAGATCGAGCAGAGTTGTGCCTGAAACACAACCGAGACAATCCAGGCTTCTTTGACATGGCCATTAACAGCGAAGATCTAAGTGACGCGTACAAGCGTCTCAAACGCCTCATCATGGAATATCTCGGCATGTCACCGCCATCTACGGTGCATTCCGAACTGTTCAGTGGTAGTATGACGTCAGTTGATACCAGCCAATCAGAGGATACCTTGCATCAAGGAAATAAATCAGGCACCAGTCAAACAACAAGTGCCACGGTCAACATGGCTGCGAGGACCTGGTCACGACGGTCTGATTCGTCCACTATCCCCCCCAAGGGAGTTAAATTGACCCAACAAAAGACACCAGTGGAAATCCTATCATTAGAACGTCGACAGACACAAGCTAAAGCAGCAGTGGCTGGAATTCACCAGATTTCACTGGAACAGTTTATGAACTCAAGGCAAGCAGTCTCGGCTACTTTCCAGCCCTCCGCAGCGCAGTACTCGCCGGATATCAAACGCTCAACCTCAGTCCCTCTCAATTTTAACGCTTCACTGGCTTCTATGGTCGCCAATGCCAGCAGTCATAACGAGGCCAGAGAGGGGGGCCTGGAATCCAACATCTCTGAGTCCGAAGAGGAACAAGAAACAACTTCATCCATCGTGTCATCTGCGCGTGGGTATTCCAACGACGAGGCCCAGTCTCCAAGAGACTCGGACGAAGAGGAGGAGGAGGACTCGAGAGACTTTCTTGAATTAATTCCAACTGAGACGTCACAAGAAACAGGTTCAGTTCCGTTTTCAGGAATTTTTGGCCAAGTGGAAATTGCCAATTCTATTTAA

Transcript

OS493_031728-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q96M69	Leucine-rich repeat and guanylate kinase domain-containing protein OS=Homo sapiens OX=9606 GN=LRGUK PE=1 SV=1
Q9D5S7	Leucine-rich repeat and guanylate kinase domain-containing protein OS=Mus musculus OX=10090 GN=Lrguk PE=1 SV=1
Q9P6I5	Guanylate kinase OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) OX=284812 GN=SPBC1198.05 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0006253 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00625 all species →	Guanylate_kin	Guanylate kinase	Domain	Interproscan
PF14580 all species →	LRR_9	Leucine-rich repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR032675 all species →	Homologous_superfamily	Leucine-rich repeat domain superfamily	Interproscan
IPR001611 all species →	Repeat	Leucine-rich repeat	Interproscan
IPR008145 all species →	Domain	Guanylate kinase/L-type calcium channel beta subunit	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR008144 all species →	Domain	Guanylate kinase-like domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23117 all species →	GUANYLATE KINASE-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0004385 all species →	Molecular Function	guanylate kinase activity	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K25549	LRGUK; leucine-rich repeat and guanylate kinase domain-containing protein	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_031728-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

53.2Max TPM

14.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	10.17	15.17
polyp at pH7 6	18	18	9.79	22.68
coral polyp · control treatment	16	16	23.81	53.16
coral polyp · oil and dispersant treatment	16	16	17.08	42.17
coral polyp · oil treatment	16	16	21.42	38.57
coral polyp · dispersant treatment	16	16	11.57	22.45
Polyp	10	10	9.93	22.74

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.17
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.08
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.50
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.01
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.63
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.99
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.94
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.94
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.93
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.80
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.77
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.70
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.39
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.13
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.85
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.18
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.49
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.48
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.68
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.53
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.01
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.36
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.61
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.17
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.14
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.10
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.95
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.49
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.22
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.62
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.36
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.09
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.99
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.52
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.40
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.16
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.06
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.28
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.52
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.86
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.67
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.21
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.63
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.69
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.46
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.20
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.36
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.58
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.30
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.64
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.31
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.17
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.82
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.75
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.87
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.76
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.78
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.21
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.93
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.81
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.07
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.62
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.61
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.55
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.31
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.95
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.09
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.57
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.38
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.02
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.00
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.20
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.80
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.41
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.16
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.18
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.14
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.22
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.21
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.14
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.43
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.39
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.54
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.45
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.56
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.31
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.50
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.88
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.70
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.35
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.70
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.33
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.35
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.21
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.76
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.43
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.88
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.19
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.54
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	22.74
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	21.31
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	10.16
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	9.53
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.46
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	7.97
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	6.10
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.30
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.13
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.59

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.