Gene detail

Detailed information of OS493_032233-T1 in Lophelia pertusa

Genomic Location: scaffold_236:177847...205425
NR annotation: KAJ7382864.1, Vacuolar protein sorting-associated protein 16 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_032233-T1

ATGGCTCACGTAACAGTTGACTGGAACCCCCTTGGGAAGGTGTTTTACAGGAAGATTGAGTTGTACAGCATGGCTTGGCAAGAAGCTGTGGACCTGTCCAAGTTTACTGTAAGTGCAGCATCGTTTGGGGGTCCAATAGCTCTGATACGAGATGACAAACATTTTGTGCGTGGCCAAGGATCATCCATCAACAAACCAATCATTCATATTTTCTCTTCTGCTGGGAAGGAAGTTGCTACTGTTAAGTGGGACGGAGCTGCTATTGTTCAGATGGGTTGGTCTGTCTCAGAGGATCTTCTGTGTGTCGCTGATGACGGCAGTGTTTTAGTTTATGACATTCATGGTGCAATCAAGAAAACCTTAACAATGGGACAGGATGCCAAGGAGTCAAAGGTGATTGACTGCAAAATCTACAACTTTGCTGGAAGGACAGGTATAGCTGTACTGACGGGTAGCTATCATTTCTATGTCGCCAACAACGTGGAAGAGGTCCGCAGTCGACGGATTTTTGACCCACCAGGTTTGGATGCTCCGCCCAGCAGCTGGGTGATATTGCCTCATGACAGAGGCTCTTCATTGCTTGTAGCAATTGACCACCTTCTGTACCTTACTGATAAGAGTCAATGCAACAAACAAACTGTGACATTTAATGAAGGAGCAGTGACGTCCATTATAGAGATGGCGATATCTTATAATTACGAGTATTTGGCAATGTTCACTGACACTGGCTTGCTGTGGATTGGATCAGCAGATCTGCAGAAAGTGTACTGCGAGTTCAACACTGCCTGTCATTCAAGACCCAAGCAGCTTGCATGGTGTGCAATGGGTGCAGTGATATGTTACTGGGACGATTACTTAGATGTGGTTGGACCAACGAAGGACACCATAAGATATCCTTTGATGGATAGTACCGTTCATTTGGTTCAGGAGTTGGATGGGGTGAGAATCATTGGTAATGACGCTCATGAGCTGCTACAGAGAGTCCCTGCTGCTGTTGAGCAAGTATTTAAAATTGGTTCAATGGAGCCCGGTGCCATGTTGTTTGATGCTTCCAAAGAATTTGAGAAAAAGAGTGCGCGAGCAGAGGAGTACATTCGCATGATCAAAGATCGTCTCCCTGAAGCTGTTCAACAGTGCATCCACGCCGCTGCTGGAGAACATGAGCCTGCAGTACAGAGAGGTCTCTTGAGGGCTGCATCATTTGGTAAAAGCTTCTTAACCGACATGCCTCCGCAGGCCTTTGTGTCGATGTGTAGATCTCTGCGAGTGTTAAATGCTGTGCGGGACTATACGGTTGGCATGCCTCTAACATATGGACAACTGGAAAAGCTTACAATGAAAACCCTGATTGACAGGCTTGTTCTAAGACGTCACTATTGCCTGGCGATACGAATATGTGATTACTTGAAGATTCCTAAGGGGGAGGGAGCCAGTCGTATACTGGGACACTGGGCCTGTTATAAAGTTCAACAGGCAAATGTTGATGACGAGGAGATAGCTCGTGCCATCAACTCTAAGCTCGGCGAGACTCCCGGCATATCATATTCAGAAATTGCTTCTAAAGCAGTTGACTGTGGAAGAACACACCTAGCAATCAAGCTGTTGGATTATGAAGCAAAGGCCGCTGACCAAGTTCCACTGCTCATGCGCATGAAGAAAGATGACCTGGCCCTTGAGAAGGCAATCATGAGTGGGGACACTGATTTAGTGTACATGGTTGTGATGCATCTGAAGGATAACCTGACCCTGGGTGAGTTCCTGATGGCCATACGTCACCGGCCTGTTGCACTCAGCCTCTACATCAAGTATTGCAAAGAACAAGATCGCCGCACACTGGTTGACTTGTTTTATCAGGATGATCAGTTTTTAAACAGCGGCAATGCCTTTGTACAGGACAGCTACAATGAGAAGACGGTAGAATCCAAGATAAAAACATTGTCCAAAGCACAAATGTCTTACCAACAAGGAAACTTCGTGTTTTATGCAAAGGCAACAGAAGAACAGATCAAACTAATGGAATATCAGATGAAACTGGAGGAGAAGTATAGAAAGTCATTCATGGATCTGTCGTTGAGCGATACCATCTACCAGTGCGTACTTCTAGGCGATCAAAAAGTAGCTGAAGAACTGAAGAAAGAGTTTAAAGTTCCAGACAAAAGATTCTACTGGTTGAAAGTAAGATCCCTGGCTGAAAGTCGCAACTGGTTAGAACTTGATAGATTTTCCAAAGCACGCAAGTCCTTAATAGGATACGAGCCATTTTTTGAAGCGTGCCTTGAATTCAGCAACAGAATAGAAGCTGAGAAATACGTTGCCAGACTCCTGCCAGAGAACAAAGTGGCATCCTTTGTCAAAATTGGGAAATTCGAAGACGCAGCAGAAACAGCTTTTGCTCAGAAAAGCGAGGAGGGTCTGGATCTAGTTCTTGGGAAATGCGCAGGGTCAAATCGTCCGCTGGCCAACCGTATTCAGGAAATGAAGGCTCACTTGCGCCAAAGACGATAA

Transcript

OS493_032233-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9H269	Vacuolar protein sorting-associated protein 16 homolog OS=Homo sapiens OX=9606 GN=VPS16 PE=1 SV=2
Q5E9L7	Vacuolar protein sorting-associated protein 16 homolog OS=Bos taurus OX=9913 GN=VPS16 PE=2 SV=1
Q920Q4	Vacuolar protein sorting-associated protein 16 homolog OS=Mus musculus OX=10090 GN=Vps16 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001418 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04840 all species →	Vps16_C	Vps16, C-terminal region	Repeat	Interproscan
PF04841 all species →	Vps16_N	Vps16, N-terminal region	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR038132 all species →	Homologous_superfamily	Vps16, C-terminal domain superfamily	Interproscan
IPR006925 all species →	Domain	Vps16, C-terminal	Interproscan
IPR016534 all species →	Family	Vacuolar protein sorting-associated protein 16	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR006926 all species →	Domain	Vps16, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12811 all species →	VACUOLAR PROTEIN SORTING VPS16	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0006886 all species →	Biological Process	intracellular protein transport	Interproscan
GO:0007033 all species →	Biological Process	vacuole organization	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0003779 all species →	Molecular Function	actin binding	Interproscan
GO:0005765 all species →	Cellular Component	lysosomal membrane	Interproscan
GO:0005768 all species →	Cellular Component	endosome	Interproscan
GO:0016197 all species →	Biological Process	endosomal transport	Interproscan
GO:0030897 all species →	Cellular Component	HOPS complex	Interproscan
GO:0042144 all species →	Biological Process	vacuole fusion, non-autophagic	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K20180	VPS16; vacuolar protein sorting-associated protein 16	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_032233-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

44.4Max TPM

17.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	14.58	17.79
polyp at pH7 6	18	18	15.29	19.19
coral polyp · control treatment	16	16	23.70	44.44
coral polyp · oil and dispersant treatment	16	16	15.59	32.58
coral polyp · oil treatment	16	16	21.09	37.54
coral polyp · dispersant treatment	16	16	17.25	32.11
Polyp	10	10	14.10	20.57

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.79
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.72
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.45
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.26
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.23
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.05
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.84
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.21
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.19
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.16
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.59
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.95
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.19
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.21
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.97
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.70
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.39
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.55
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.19
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.35
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.21
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.75
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.79
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.65
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.56
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.51
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.42
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.07
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.81
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.25
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.14
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.05
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.67
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.46
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.87
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.42
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	44.44
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.02
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.28
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.74
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.86
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.09
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.26
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.90
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.75
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.88
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.22
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.64
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.16
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.42
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.87
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.59
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.58
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.15
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.32
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.12
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.96
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.02
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.40
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.30
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.87
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.88
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.14
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.63
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.08
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.55
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.89
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.50
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.54
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.12
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.23
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.70
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.38
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.16
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.83
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.91
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.01
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.73
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.28
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.23
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.86
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.04
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.21
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.26
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.11
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.28
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	28.17
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.50
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.23
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.93
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.85
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.25
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.22
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.76
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.39
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.39
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.65
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.88
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.43
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.90
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	20.57
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	19.21
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	16.00
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	13.76
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	13.68
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	12.25
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	11.95
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	11.84
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	11.30
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	10.46

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.