Gene detail

Detailed information of OS493_032311-T1 in Lophelia pertusa

Genomic Location: scaffold_238:204996...212108
NR annotation: KAJ7370421.1, Breast cancer 1, early onset [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_032311-T1

ATGTCTACGAAGGTAAAGGATGTCTTGGACGCCCTTCAACAGATGCAGAAGAGCCTTGAATGTTCGATATGTCTTGAATTGTTGAAGGACCCTCACTCCACCAATTGCAATCACCAGTTTTGTGGTCAGTGCATCAGGCAGGTTCTTGAAAAGAGCAGCAAGAAATCAAAGAACAAGTGGTACTGTCCACTCTGCAAGACTCCTGTATCCAAAAGGAGCCTGACACCAAACCCTAAACTAAATGAAATTGTTGCTGCAGTGCGCAATTTGCAGGGAGCAGTCCAAGAAGACACTGGAATTCCAACAGGTTCTCCACCTTTGCGGCCATTCAAATCATCTAGCATGGCTGGTGCATCAGGTTCTGTTCATTTCTCTACTCATCATCCAACTCCTCGAAAATTCCTGAATGACAGCAAGGATATAAAACAAAAAGCTTCAAACAAGAACCAGTTTAGTGTGTACATTGAAAATAATGAGAATCTCGACCAAGCTCTGGAAAGTAAACAGCCTCAAGTTATATCAAATGTCAACATAAGGTCAACCTTAGGACCATCGCTAACACAAACAACAACAAGCAGTGAAAAATCTAAGAAATCGTCCAACACAAAAACTACAAGAAGGACAAGAAATTCCAGGAGAATAGCTCAGGAGAATCAGCCAGGGGAAAGAATAAATGGAAGGAATGTCAGTGAAGAGCTGCTACATATGATAGACACCTTGCCATTCCAACCAGTGTCAAGAGAAGGTCCAACTTGTCCGACTCAAGATGAGGCTCCAATGGCAGACGAACCTGAACCTGAACCAAGCAAGACAACTGCACCCAGTCACAACTCAGGTCGCTCAACAGAAACTGCAAGCTCAATAATTATTAATGATCGAATCACAGGCAGTAAAGAAACTGACCAGAGCACTTCTGTACAGTGTGAAAGAACTGCATGTTTAACAACTATCGCTGAGGCGGACTCCTCTATGAGGACAAGCCCTTGTGACAGCACAGCAGTCTGTGGAAACACGGAGTCTTTACCGCCATGTGTAAATACGACAACTAACGACAAGGAAAATGAAGGAGCAGTGTCCAGCACAAAATTTGACTCTTGTCCTCTGAGTAGTTCGGATACCATGCAAAGTGTCTCTATCCTTCCGTCCCTGGACTGTCATGAACAATGCAATGCAGTTCCTGGCCATGTTCATGGCGAAAACCAACAGGATGGTGCTCGAAGAAACGAAGATGCCATCTGTCAGGATACTAAAGGAAGCGAGCTGATCTCAACTGAGAGTTGTGATGCAAAAAATCAAGAGGAACCATTTATAGTTTTCAAAGAAAGACAGGCTAGTGATTATCAACAAACACCTCAGTTAAGTCAATCCATCAACACGCAGTTGCCTACTGGGTGTATCTCGGGCAGTGTTACTGATCGTGCAAGTTTGGACTTTGAGGGTCTAGTTTCGTTGTTTGATGATCCTTCTTTGAGTAAACCTGAAGAGGCATTGCAAAAAAACAGTGAATCTGAAAAAGAACATCCAAATTCAAGTAAATCCGTGACTGAGGAAACATCTTCACCCGTCAAGGAAGAACGTGTTCACGCGGATGCACCAGAGACTGATGCTACCGATTCTGATTTGTGTGAACGCGTTAAGAAGAGGCAAAGAATAAGGCCGTCCAATATATCAGTATTGCAATTAAACAGACGTTCAGAACCGGTCAAGAAATCTGGCCAGTTGAAGACCAAGACAAGAAAGAGATCTGTGGATTATGTCGCTGTGTTAACACGTGATGAGCCCATCCCTGATGGAAATGCCAGAAAGAAGTTCAGAAGAACTGAGGTTTCTTCTCTAGGTGAGGCCTCCCCGCAGATGGTAAATACAGAAAGTAAGTCCCAAGAGGACAGTGGACTTTCTAATGAGTGTAAAGATATCAAGGAAGACGTAAATGGTTCTACAGGTGCATGTATTCTCGTATGTGGTAAAGATGATGAACAGGTTGACGACGATGCATTGGGAGTCGACAGTCATTTGTGTTCAAGCGGTAAGACCGTGCTTTCATATGAAATGATTCCAGCTAGCGTCTCCTCGTCAGAGAAATCGGTATCTCCAGTTATAGATCCAATGATTGCTCATGTCCATCAGGCTTTAGAAGGCGTGCAAGGAAGTGCTACAAAGGACACAGAGGAATGGGGTTCGCAGAATATGATGGAAAATGGCCATGCGGAAGTAACCAAAAATCATACCCCTGTCGACGATTGTTCCCGTAAGATTGCAACGTGCGAAGAGAGTCCCCAAATAAAACCAGTTTGGCACAAAGAAAACCGAAAGATTGACGAAAATCTAGACAAAGAAAATTCACTCCAAGATCACGAGCCTGGCACAAAGTTCACGACATCTGAAGTTTCCAGTCCAGAGAAACCTTTTATGACGGCTTCACGGGTGGTTGCGTCGAAACAAAATATCAGTCCTAAAGGAAAAGAAAAGAATAATCATATGGAAGATGGAAATAAAGACGGCTCAAGTCAAGTATCGGTGACAAGTCGCCAGGAATCTCAGCCCTTCGATCCCAGTGAGGACCTACTGCTGAGTGTTTGTGACCCAAGTTCTCAGTTCCATGAAGAAGTGGAAGAACCGGCGCCTGGCCGAGTGGACAGTAACGTGACCCACAAATTACGAAACGACTGCAATCCCTCGCTGGAGTTAGGTCTGAACGAGAGTCATTTGGCAGGTGCTTTTAATAGCCGTTCGCAGGAAGAGATCTTATTAGGTGAAACGGGGACTACCGGTAGTAAAATAAAGGGCAAATTGTCAAAGGAGTCTGCTGAAGCTGAGGGCAAGACACCTCAGTCATTGAGTCAAGAAACCGGGTTTTCAGACAACACTCCATCGCAAAGTTCCCTGGAAGTCATGGATGCCATGACACCCTGTCTGTTTGGAAACGACAGTTGGGACACACCAGATAAGAACATGACTCAGAAGACATCCAGAAACCAAAGGTGTCACAATAACGTGCCAGAGGTCAGTGCAACCAGTTCGAAATATTCGCCCAGGAGTTCCAGAGCTCTTGGCCCAGTGATGAAACTGTAA

Transcript

OS493_032311-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6J6I9	Breast cancer type 1 susceptibility protein homolog OS=Macaca mulatta OX=9544 GN=BRCA1 PE=3 SV=1
Q6J6J0	Breast cancer type 1 susceptibility protein homolog OS=Pongo pygmaeus OX=9600 GN=BRCA1 PE=3 SV=1
Q6J6I8	Breast cancer type 1 susceptibility protein homolog OS=Gorilla gorilla gorilla OX=9595 GN=BRCA1 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005091 (this species only)
Ubiquitin family	E3\|E3 activity RING\|RING · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 activity RING\|U-box · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00097 all species →	zf-C3HC4	Zinc finger, C3HC4 type (RING finger)	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR018957 all species →	Domain	Zinc finger, C3HC4 RING-type	Interproscan
IPR001841 all species →	Domain	Zinc finger, RING-type	Interproscan
IPR031099 all species →	Family	BRCA1-associated	Interproscan
IPR017907 all species →	Conserved_site	Zinc finger, RING-type, conserved site	Interproscan
IPR013083 all species →	Homologous_superfamily	Zinc finger, RING/FYVE/PHD-type	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13763 all species →	BREAST CANCER TYPE 1 SUSCEPTIBILITY PROTEIN BRCA1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0046872 all species →	Molecular Function	metal ion binding	Interproscan
GO:0000724 all species →	Biological Process	double-strand break repair via homologous recombination	Interproscan
GO:0004842 all species →	Molecular Function	ubiquitin-protein transferase activity	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0006281 all species →	Biological Process	DNA repair	Interproscan
GO:0006974 all species →	Biological Process	DNA damage response	Interproscan
GO:0031436 all species →	Cellular Component	BRCA1-BARD1 complex	Interproscan
GO:0035066 all species →	Biological Process	obsolete positive regulation of histone acetylation	Interproscan
GO:0035067 all species →	Biological Process	obsolete negative regulation of histone acetylation	Interproscan
GO:0045717 all species →	Biological Process	negative regulation of fatty acid biosynthetic process	Interproscan
GO:0045944 all species →	Biological Process	positive regulation of transcription by RNA polymerase II	Interproscan
GO:0070531 all species →	Cellular Component	BRCA1-A complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_032311-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_032311-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

98TPM > 0

7Conditions

25.8Max TPM

0.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	16	0.38	0.94
polyp at pH7 6	18	14	0.36	1.21
coral polyp · control treatment	16	14	2.19	25.84
coral polyp · oil and dispersant treatment	16	16	1.42	15.33
coral polyp · oil treatment	16	16	0.63	1.63
coral polyp · dispersant treatment	16	15	0.68	2.08
Polyp	10	7	0.26	1.30

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.94
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.84
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.66
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.48
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.48
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.45
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.44
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.44
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.38
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.31
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.30
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.28
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.26
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.23
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.23
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.10
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.21
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.01
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.69
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.56
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.53
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.46
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.43
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.28
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.26
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.26
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.21
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.20
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.20
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.20
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.84
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.19
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.18
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.14
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.02
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.90
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.79
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.68
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.54
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.44
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.40
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.40
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.38
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.18
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.00
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.33
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.99
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.87
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.82
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.76
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.62
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.59
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.49
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.48
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.42
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.40
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.39
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.21
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.20
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.08
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.07
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.63
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.19
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.98
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.74
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.72
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.68
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.59
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.54
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.52
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.49
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.48
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.46
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.44
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.31
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.16
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.13
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.08
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.38
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.24
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.10
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.96
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.89
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.62
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.50
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.49
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.39
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.29
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.29
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.26
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.22
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.12
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.30
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.34
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.30
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.28
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.15
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.14
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.13
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.