Gene detail

Detailed information of OS493_032545-T1 in Lophelia pertusa

Genomic Location: scaffold_244:134538...137152
NR annotation: KAJ7370369.1, E3 ubiquitin-protein ligase [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_032545-T1

ATGGCGGATGATTTCCCACTTCACGACGCACTACAGTCAAATGATATTGAAACTGTAGAAGAGTGTTTAAAAGATGGAGAAGACCCAAATAGGATAAACGACATGGGAGACGCACCGCTACACTGTGTCTACTACAAGGACAAGGATGGGGCTTACGAAATGGTTCAACTTCTGCTGACCGGCGGTGCAGATATGCTCATCAGGGATGGTGCAGGAAGACTACCATTTCAAAAAGCTTTAGACGCGGCAAATAAAAAAGCATGCCAGACTTTCGTACACGAGGGATTTTCCCTGCAAAAATCTCATCGCATGCGAAATGGAACTTATGAGGTACTTAGCATTGTCCATGGTAAAATTTTTACCATCGAGGTACTACAAGTTCTTGTTGATCTTGGCGTCGATCTATCTGCTACGCTATCTTCAAGAGGTGAAAACCTTCTGCATAAGGCGATTGAACAGGGTGCTAGCATAGAAACTATACAGTTTCTGATACGAGCTGGAATCTCGGTAAACAGCAGGAATTCTTTAGGAATGACACCCCTGCATATAATGTGGAGAATGCTTTATGCTATCCATGACCGTGATGCAGAGCTACTGTCAAAAATAGTGAAACTCTTTGTGAGTGAAGGCTACGACATCAATAGTCAGGACATGTTTGGACGTGCACTCCTACATTATGTAACAGCTCAAACTCGGACAATAGTTGAACGAGGACAGACCTCTCTCTTGCAGTTTATTATTGACCATCATGGTACAAACGTAAACATCAAAGACAGAAATGGTGTTTCTCCTTTACATTTGGCATGCAGAGATCGTACTCGTACTGCAAAGGTTTTGATTAAGAATGACTGCTTGGTTGATATCGCAGACAACAATGGAGCAACTCCAGATAATTCTGGTCGAACTCCACTCCAGTGGGCCAGGTGCTTTGGATATGTGCAACTAATTGATCTCTTTGAGGACTTTTTTCGGTCATTGAGCAAAGGTTTTAAAAGAGAAAGGCTACCTGATGTTTTTCCATTAAGAGAGTCAGGCGAGTTTGATAGTTACAAGATGCAAGAGGTTGAAAACATGCAATCAGAGGACTTCTCTCTAAACACTGACCCCAGCAAAACACTCCAGAAGCTGCTGAATTCACCCATCATTGGTAAACTACCAAAGATTACAGAAACGAAGGATGTCAAAAATGCAGTGATCAAAGTTATGGAGCGGGTGGCAGACGAAGTTTCAAAAACGTGTCCTCTATTTACTTTTTGTTCTGAAATCTCGGGCAGCATAAGCGAAAAAACCAAATGTGGATCTCCTGATGAGTTTGACTTCTTGTGTACAATGGACAAATTTAGTAAGTGTTTTCAAGAGCCAACTGTGGCTTCCAGTCCTTCATTGTTTTGTCGACTACAAATTAAACCTGATTTGTGCCTCCCAGATCACAAAATTATACAATATGTGGACAAAAATAACAGTTTAAGAAGTTCACAATTGATCCTTGACTTCATTGGTGTACTTAACGAAGCCATTTTGGAAAAAGAGATTTGGGACGATATTTCGGCATTAGCACCAGTAAGTAATTGTTTAAAACAGGCTAATAATACAGTAAAAATTACCCTCAAGTGGCATGGACAAGTTTACAGAGATTTGTTGATCAATGTAGACATTGTCCCGGTGTTGCACTTCCCCAACTTCTGGCCACCAAATGTCTCTGAATCAGCATTGTTAAACTCACAGATAAAGAAACAAGGAGTTCATGTTATCATGGGGATGCATGGTGAATCTCTTAAAAGTGGAGAAAAACACTTCCGTCTGTCCTTTTCTCTTGCTGAAACCAAAATATTTGAGGCCCTTCCAGAGTGGGTTCGTTTGAGTTATATTCTTGCAAAGGCAGTGAGAAGTTCTTATACATGCCCAGGAATTGCACATTCAAGGATTGAAACAGTGCAAGAGCAACCAAGTGGTTCTAGATGTGATGATGATGATGATGATGGTGATGATGATGATGACGATGATGACAACGATGCTGCTTCTGATGAAGACAATGATGCTGATGATGATGATGATGATGATGATGCTGATGATGATGATGATGACAACGATGCTGCTTCTGATGAAGACAATGATGCTGATGATGATGACGACGATGACAATGATTTCAGCAGTGCAGAGGAAGTTATTTCCAGTTACTTTTTAAAAAATGCGCTGTTTACCTTGGTGAATAAAGCTTATCAGAAAGAAGTTGACCTGGATGTACAAAATTCATCTGAAGACCAAGTTATTATTTGGGCAAAACATATTTATGATTTCATTGAAAACTGTCTTGAACAGGAGAAGCTGCCATCTTTCTTTGTACCCGGTGCAAACTTGCTTGAAAATACCAGTTATAAGAAGGATCAGCACTCAGATGTGTTTCATGGTGAAGTGGCTATGGATGCATATCAGATGCATGATGAAAATAAGGAATCAGAGGACAAAATGAAAGATCATCTGAGAAAACCCTTTATTAAAATGTTAAAGGGAATTCTGCAGTCTCATTGA

Transcript

OS493_032545-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0007975 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00023 all species →	Ank	Ankyrin repeat	Repeat	Interproscan
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan
PF03281 all species →	Mab-21	Mab-21 protein nucleotidyltransferase domain	Domain	Interproscan
PF20266 all species →	Mab-21_C	Mab-21 protein HhH/H2TH-like domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan
IPR024810 all species →	Family	MAB21L/Cyclic GMP-AMP synthase-like receptor	Interproscan
IPR046903 all species →	Domain	Mab-21-like, nucleotidyltransferase domain	Interproscan
IPR046906 all species →	Domain	Mab-21-like, HhH/H2TH-like domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24126 all species →	ANKYRIN REPEAT, PH AND SEC7 DOMAIN CONTAINING PROTEIN SECG-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_032545-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_032545-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

107TPM > 0

7Conditions

11.8Max TPM

2.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	1.80	3.98
polyp at pH7 6	18	17	1.78	4.11
coral polyp · control treatment	16	16	3.26	11.85
coral polyp · oil and dispersant treatment	16	16	2.54	8.52
coral polyp · oil treatment	16	16	2.26	4.06
coral polyp · dispersant treatment	16	16	1.88	4.05
Polyp	10	8	1.05	2.93

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.98
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.42
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.10
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.83
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.67
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.13
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.94
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.86
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.63
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.36
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.28
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.17
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.10
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.01
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.92
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.79
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.61
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.56
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.11
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.83
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.53
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.42
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.32
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.16
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.70
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.48
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.41
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.37
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.21
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.19
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.99
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.94
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.86
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.76
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.72
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.85
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.67
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.53
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.35
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.91
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.89
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.54
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.00
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.55
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.71
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.55
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.45
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.41
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.38
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.32
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.15
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.52
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.70
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.89
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.73
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.69
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.54
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.36
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.99
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.89
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.70
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.53
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.28
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.07
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.01
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.87
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.84
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.06
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.88
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.50
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.17
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.79
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.51
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.42
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.40
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.31
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.85
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.56
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.37
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.30
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.24
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.22
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.65
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.05
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.26
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.19
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.58
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.57
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.49
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.38
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.34
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.69
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.61
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.40
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.88
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.58
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.41
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.35
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.33
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.93
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.38
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.73
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.96
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.94
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.64
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.62
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.32
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.