Gene detail

Detailed information of OS493_032690-T1 in Lophelia pertusa

Genomic Location: scaffold_247:164965...190270
NR annotation: KAJ7389222.1, hypothetical protein OS493_032690 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_032690-T1

ATGCCAGTTCAGACAGAGCGTTGCGTCAATCATTTCGGAATAGAGGTAGCAGACAGTGTCACATGGCAGGGATGGGAGCCTGGTGGAGAATATACTCAACAAATTGTGCTTAAGAATGTGCAGATTAAAACACAAAAGCTCCAGTACAAGTCTCCATCTAGTAGATTTTTTACTACACTTTATCCTAAGCCTATTGTGTTAAGCTCTGGAACCAGTTTTACCCTGCCTGTTACATTCAGACCGCTTGAAAAGGGACAATATGAAGACTGTATACAATTTGAAGCAAATGATGGACTTTTTTCGGTTCCCATGAGAGCTGTGTTACCCAAGGCTGACATAGCAGTACCGGATTCTTTAAAGTTTGGCATGTGTGCAGTGAAAGACTGTGTACAAGTTGTATTTCAGATCACAAACACCAGTGAACTGGTGACTAATTTCCAGTGGCAAGTGTTGGAGCCATTTTCTATTGTACCTGAAAGTGGAACATTGGCTCCAAGAACATCATGCAGCATTAAAGCAACATTTTGCCCCAAGGCAGCATTGGTATACGAAGCCACTGCAGTGTGTACATACAGTGCTGGACAAAAGACTCCCTTCACAAAGCATGTGAGAATTGAAGGAATAGGTAAATTTCCCCATCTTGTGGCCAGTATATCAGGACCTACAAAGACTTCATCTACAGAGCTCTCAAGCAAAGAAGAAGTGGTTTTGAACTTTGGTGAAGTTCCAGTTCAAAGCAGTGCTACGAAATGGATCGAGCTTCATAACTTCTCTCCAGTAAATGCACCATTCCAAGTGTTACAGCCGTCATGTGCTTCTAATATTGATACAGTATTTGCAAGTTCACATTATCATGGTGTTGTCCCAGCAGAAAGCACTATAAAACTTAAGGTGTCGTTTACTCCTCAAAATCCTGGCCAGTATTCAGTGGATTATCTGGAAGTTATAGCTCTTGGTGCTACTAACTGTTCTGTTATCAAATGCACTGGAATAGGCAAAGGACCTGAAGTCGTCTTTGACTGCGACTACCTTGATATGGGAGTAGTAGAGTCTGGCAAGTTTGTAGCTAAAAGTTTCAAGGTTATAAACAATACTGAAGTCCCTGCTGCCTTCCAGTTCATGATCGACTGTAGTCAAAGTGTGTTCAAGTTGGAGACAACATGTGGTTTACTGCCAGGCAAAGGTTCTCAGACTGTTATTTTACGATTTTCTCCAACAAATCCCATCAATTACTACAGGAGGCTAACTTGTCTTGTTCAAAATCAGGATCCATTGTTTATTGATGTGTTTGGAACTTGTCACACGGAACAAGTGAAACCAGCTGTTTTGGAGAAGAAGCATTTGGATAGGTATCATACTCATGTCAGTCGTGGATTCTCAAAAATAGCACCAGAGCAACTTAATGAAGATCTGAGAGCAAACAAACTTCAGCTTGATGCAGATGGAGCGTTGATGGCACCAGAGAGCACTTCATCAGGAGACATGCTGCCTTCAATGTCTGAACTGTCACCCATGGAAGAGTTCTTCTGTCATGCGTCAGTAGGAGAAACAACTGCAGTCGTCCCTCATGTCAGTTTAGATATTCACCATGCAGAGTTTGGACAGTTGCTGGATCCTAAAGCAGTGGAACAGAAGACAGTCAACATAACGAACCACACAAAGGGAAAAATAACATGCACGTGGATGAAAGATACAAAAGGGGTATTTTCTGTTTCTCCTGAGGAATGCGACATCCTTCCCTTGAAAACTGCTTCATTTAGAGTGACATTTCGACCTAATGCTGCAAATCAGTTTTTTAGTGCTGATCTGGAATGCTATGCATTTTACAAGAGTATGAGAGATTATCGACTTGTTGAGGACACTACTCTCTGTCCTCCCTGGTGTCTCTCACTAAACACTACAGGGCATACATTTGCACTTGGTACTGAAACATTTATCCCCAGAAGCCAATGGGATGTGAAGCACTTGGTCTTTCCAGCTGTGACTGTGGATGGTGTGTCATATAGAACTCTGTTGCTTAACAACACTGGGCATAATCCTATCCACTTTGCATTTGATGACGATCCATCAGGGGAGTTTACGTGTCGACCAAGGACAGGACTACTCACTGGCAAATATCAGTTGATTGTTTTCAAAATGACACCCACAGAGGCAAAGATCTTTAAACACACTCTCAAGTGCAAGCTTAACGATGCCGACAAGTTTACTCAGGAAATCAGCCTTGTTGGATCAGCAGAGACACCATCTCTGAAGCTTAATAATCAGGGAACAGTTTATTTCAAACCAACTTGTTTGGGAACTCCATCTACAAAGTTGTTTGAGCTAAAGAACACTTGCAGGATTCCATTAAGCTTTTCATGGAAGATTCCTGGACCTCAGGTTAAAATTCTGAGTATTTATCCTTGTGAGGGAGTCATCTTACCTAATGAGACTCAGGCTCACACATTCAACTTTAGTCCTCGGGAAGAAGACAAATGTGTGATCAAGACAAAGCTTACTGTGACAGGATTACAAACAGACGTCCAACAACAACAGTCACCAGAGGAAAAGACCTATTTAGTGCGAGTTATTGGAGAGGGATCTATTGGGGAAATAGCATGCACAGAGGAGGCTGTAAAGTTTGGTGATATTGTTGTGGGAAGCTCTGCATCTCGAGAGCTGACAATCCACAACAACAGTGACTGCAGTCTACACTACAACCTACTTATTGACCAGGAGATAACAGGACCTTATGATGACGAGCAGTCTGCAAGAGATGTACTGGCTCTGGAAATAAGTAACCAGGATGGAATTATTCCAGCAAGAACTTCTCAGAGGATATCAGCGACTGCTTATCCATCTCGCCGGGTTTGCTACAAGTTCAATCTCAGTTATGAGCTTCTCTCCATGTTTGATGATGGTAAGTCTTTAATAACCTGCCCCAAGAGACAGCTTGTTGAACTGCAGTGTCAGGGAGTGTATCCCACTCTCTCCATGACTGATGCTCGCTGCCTGGGGAGTGCTAAAGGTTACAGTAAAGTACAGATATGGAACCTCTTCTCCCTGGACAGTCTCAATGAATGCCTGGAGTCTGATCCATCTCCGTCAGAACTTCTTTATGCAGCAGTCACACGCCATAGTACGCGGCGCAGAGTCCCTGTGAACACAAGAGCCATCATGGACTTCAATTTTGGAGCAGCACCTCTGGGTGGGGACCCATGTGTTGTGCATCTGAACCTGCAGAATACAGGCTCAGTTCCTGCTGAATGGGCATTCTTGTATCCAAGTGATCTTCAACTTGAACTGGAATATTGGACAGAAACAGGAGAGTATGATGAAGATGAACTTCATGAGATGCAGGTTATGGATAATAGACTATTCAACATTGAGCCTAGGAAAGGGAAGCTGTTGCCAGGAGAATGCCACACTGTTACTCTTACATACAGCCACTTGTTCACTGGAACCAACAGACTTCCAATCCTGTTCAAGGTCATGAGAGGAAGAGAAATCCTGTTGAATTTCATTGGTGTGACTGTGGACCCAGACAGCTTCTATGTTCACTTTGCGGACACACGACATCTGTTTGAACCAGTCCCTGTGGGAGGGACATCACCACCAGTACAAGTGTATGAACTGTACAATGGAGGAGCCAGGGTTGTTAACTACGAGCTGGATATGGAACCACTTGCACAAGTCCAAGCTCAAAACTATGGCTGTCGTATCTTTGAGTGTCTGAATCCGTCAGGGGAGATCCCTCCTGGCTGTGCTGCGCTGATTTACTGGCAGTTTGCACCACTTGAAGCAAGAACATACATGGTGGATATCCCAGTACGCATTATCGGCGGGGAGACAGTGTTGGTGACATTCACTGGTGTGGGTTATGACCAGCGGATTATGGGTGACACCCTGCCTGTCAGAGATGTGTGTAGCACCACAGTACCTGATAAGCAGATAGTCCAGGTGCCAAAACAGCTGTCATACTTGTCAGTGGAATGCATTCCATTTGGTGATGTTCCTTTGTACACGATGTCTCATCGTATGTTCTTCCTGACTAATTCATCACAAGAGCATATTACATCCTTCAGATGGATCCTAGAGGGGTCTGCTATGGAACAGGTGATAATGATAGAACCTGACCATGGTTTCCTCAAACCACAGCAAAACGTTCTGCTAAAGATTTCTTTCTTTTCCTGTGGAGCACCGTCACTTTATGACATGGACTTAATATGTGAGATTGTTGATGAAACTGAGATGGCAGAGTACAATCAGCGGCTTATAGACTGGACCAACATGAAGGAAGAGAAACAATACACCTTCACAATAACCGAAGATGATTTGAAAAGGCCTCATTCAGGACCACACCTTAAATCCATCAACCACCCAAATCGATCTATGTCTAATTCTGAGGGAGACTTGAGGAAGTACCAGGCTCTGCCTCCAATCGGTTCACCCAAAGAAACAAAACGAAAAAAGACCAGCAACTCCTCCTCCCGACAAGAGACACCACCACAGCCTGTCCCCCCGGAATCCTTCTTGCTTCATCTGGGAATCACTGCAAGGACCCACGCGATAGGAGAGTTTTACAAGAGCTTCCCATCAACAGTGGACAAATTTCTGATCGATCAGCGTTATGTGTTGTCTCAAGGGACTGGTGACCACGATAAAGAGGAGCTATCTGCCTTAGTCTCCTGCTCGAGACCGGAAATGGGAATTATTGAGGATGTACTCTCTGTTATATTCAGGGGTCTCCTGGATGATGACAATTTCTATCAGAGAATGTCTGAGATAAACCAGGAGCCTGTGCCCTACTTTAGACAGCTATGTGAGACACAGTACACCACCAGCTCCAGGCCCTCCTCTGCCAGCAGTCAAAGTAGTAACCAGTCCTCTTCTGGCGAGCGGTTCGGTGGTGAACTGGAACACTTGCCTCGTACCAAACAGCAGACTAGTGGTGAACACACTGGTGGAGCTGCAGAAGAGAGGGTGATGAGTAGAACACATCAGATCATACAGCGTACCTCTGACTCGTCACTCTCCATAGCTGATAGACTGTTGGACGCTGATAGCGATCCTGAAACCATGACGTCACAAAGACAAACAGTGCGCAGATTGCCCGAGTTTGAGTCACTAGTGGAGTCCATTATGGAGAATTCACTTCTGAATTTACTGACGGAAGCAAATCATGGAGAGGTTAACTTGACATCACGGACTAGAGTGATAGCCCTGCCACCAAACAGAACAAACAAGTCAACAAGATAG

Transcript

OS493_032690-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
F1P4W9	Cilia- and flagella-associated protein 65 OS=Gallus gallus OX=9031 GN=CFAP65 PE=2 SV=2
Q6ZU64	Cilia- and flagella-associated protein 65 OS=Homo sapiens OX=9606 GN=CFAP65 PE=1 SV=2
Q3V0B4	Cilia- and flagella-associated protein 65 OS=Mus musculus OX=10090 GN=Cfap65 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003715 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_032690-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR052614 all species →	Family	Cilia-Flagella-Associated Protein 65	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR46127 all species →	CILIA- AND FLAGELLA-ASSOCIATED PROTEIN 65	Interproscan

Gene Ontology

No Gene Ontology signature was detected for OS493_032690-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24226	CFAP65; cilia- and flagella-associated protein 65	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_032690-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

53.8Max TPM

14.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.90	21.02
polyp at pH7 6	18	18	10.38	14.43
coral polyp · control treatment	16	16	19.82	53.83
coral polyp · oil and dispersant treatment	16	16	15.44	47.26
coral polyp · oil treatment	16	16	17.16	27.00
coral polyp · dispersant treatment	16	16	12.90	26.48
Polyp	10	10	11.74	20.67

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.02
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.42
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.02
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.89
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.41
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.10
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.06
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.61
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.54
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.45
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.85
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.54
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.06
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.32
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.18
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.84
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.60
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.36
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.43
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.21
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.02
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.94
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.88
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.87
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.72
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.35
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.15
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.91
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.91
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.56
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.47
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.02
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.90
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.77
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.50
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.23
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.83
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.26
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.75
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.65
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.74
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.73
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.41
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.89
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.66
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.14
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.46
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.38
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.16
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.99
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.05
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.04
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.26
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.66
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.39
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.79
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.05
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.94
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.36
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.72
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.61
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.31
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.91
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.61
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.56
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.96
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.14
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.85
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.00
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.75
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.03
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.96
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.74
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.48
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.94
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.67
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.35
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.12
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.07
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.65
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.30
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.30
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.11
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.09
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.48
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.85
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.55
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.33
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.30
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.11
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.04
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.86
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.55
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.50
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.46
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.39
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.35
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.14
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.50
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.98
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	20.67
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	12.48
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	12.09
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	11.93
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	11.86
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	11.24
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	10.74
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	9.74
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	9.69
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.90

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.