Gene detail

Detailed information of OS493_032748-T1 in Lophelia pertusa

Genomic Location: scaffold_248:153429...159091
NR annotation: KAJ7382789.1, negative regulation of double-strand break repair via homologous recombination [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_032748-T1

ATGCTAACTGCTGGTTGCATTTCAAGGATAAAAACCATCGCAGGTAGGGATGAAACGCAGGAAGCGTTTACCGTGAAAGTGTTAAACATTCACAGATACATTGTGGACAAGAGCTTTCCCATTTTGGACCCCGATTTTACTGACGCTTTCGACATCGTGATAACTGATGGTCGGTACAAGACGAAATGTGTGTTGTCAACCGCGCTAAATTCCCTCGTTTATGAAAACAAACTGCGAAAACATTCCATCGTGTCGGTTACAGAATGCAGTTCCTTGATTGACGAGGAATCACTGGATCAAGCAGTTTATGTCATTCTTCAAGGAATCGAAATTTCAGATTTTGCGCCAGATGATGAGGGTCCCGAACAAGAAATTGAATTTTGCGAAGATGCAACACCGAACGAAACGCAAGAACTACCCCTAGCAGCGTCTCGCGGTTATTATTTGCCATTATGGAACGACGAAGACTATTTTGGTGCGAAGTGGTTTTGTGATCCAGACTTGCAGCCTTCCAACCCCATCACTGGTGCAATCACAATTTTTGATCTTGACTCGTTTTGGAAAGTTCTGCCGCGTCCATTTCCAGCACTGATCGGGAGAGTAGTGAGTAAAACCAGGCTTAATCACTACGGGAAAGCAACGGACGAGAATAGGAAATATCCTTATCAGGCTTACGTTGAGCTTGAGGATCGCACTGGGACGGTGTCTGTGTGTATCTGGAGTTCTTTTTGTGTCCTGCTGTATAATTACCTTCAAGTTGGAGACATTGTGGCAATCTCGAATTACCGTGTTACCAGGAAGTTTGGTCAGAGGAGTAATGCAGTCTACAACACAAGTGCTGCCGCTAACATTGAGATATCTGTGAATCCTACCAATCCCACCGCAGAAGTATATAAACTGGCCGCTAATGAGCTTGGTCCTGTGTGGAGATTGCCTGGTGTACCGTACAGGTTTATCAACAGGAAATCACTGCCCAGCTACTCATCAGGTTTAATATGCGACATTGTGGGAGTGGTGATGTTTGTCAGCAGAGACAGCAGGGAGAGAAAGGGAAACAGGTCTTCCTTTTGGGCCAGTAAATGGGTTCATCTGCAAGATGGGACAAGTGTCATGCCTATCATCCTTCATCTTTATGCCTCGTCACAACCTGAAGTCTTTGATTCCATTGCACCAGGAAAGGTACTTGTTTGTGCCCGTATGCTTCTCAAAATTGAGGTTCAGGATTCGAAACATCACAGATTTTGTTTCATCACGACTACCCGTGAATCACAGCTTTACCTTCTGAAGAAGCCATCAGACGTGAATGACAAGCCCTTTGCAGAATCTGCTGCCGTCAACGAAGTCATCAGATGGCGTCAAACTGAGGATTCCAAACAGCTTCTCAGGAAATCTTCTTGCAGGGGAGGGTACTACAGCTTTCCACCTTTGCCCCACAACCTTGAATTATACAAGAGGACGTTCCCTGCTGAGAGCCCAATGAATCTAATGACAACGGTGAACCTTGGGTTCATACTGAAGGAGCTCCACTATAGAGAGCATGTGCGGCTGCATGTCCAGGGTGTAGTCGTAGCCATGGAGTTTGTTCCTGCAGCTAGTAGCAAAGGAACTTCACACCAGACATCTGGGGAGGTCACTTGCTCCCAACTGTGTGAGACTCTGGGTAGTAGCAAGAACAGTGGAGAATCCTCTTCAGTCCGCCCTACAAGCCAGTCCAGTGACAAGTCAATGCCTTTAACCAGTGGATCAGGCGCAGATTCTTCATCACAAAATGACAGGAAAAAGCTCAACACCAAGAGAAACCACCACATGCAAACACGGAATTTGAAAAACATAGCCGATTCTGAGTCCAAAAGTGAGGACGAGTCAACTGCTGTAAGTGTTCCCAGGAGAATGAACCCCAACAGGAAATGCAAAAAAGTTGATCAAAGAAGCCCTAAACAGGTTCAAATCAAGACAAGGGGACACGAAGTTGCTGCTGAAAGTGTGGCCCCTGCCAGAAAGCGAAAAGCAAGAAAGCGACTTGCCCACATGCCAAAAAAAGTGAAGAGAAAAGCGACACAAAAGAACCCAAAGTCCATCGACGTCACAGAGAAAATAGGCAAAATATCAAAAGCCAGTCAACCATCAACAAGCGGAGATGAAGATCTTTTAGAGTTCTCTGATAGTGTGCCATCAAGTTCTGTGAAGCCAAACAAGGCAGTGAAATATTTCCCCTTCAGAATTTTGGATCAGTCGTGGAGACACATCGCAGCAGACACACCCCAATTGGGCTTGTCTCACCATAGCTTGCACGAGAACACTCTCCCTGCACTCTGCAGTCGGGGGCTTTCGGATGTCAAAGTCGTCCCGAGAGCCGATCGGCAAGGCTTCGTGAAAACCGACGGCTACTGGAGGCTAATGATCGCCGGACTCAATCGACGTGCGCTCATCAACGCAATATTTATCCCCCAGTGCCCGGCGAGAACGGAAGACGTGGAAGGCGAAGAACCAAGAAACGGCGTGTTTTTGTCTGCTTTAGCCACAGGGGCGTTTCCAAACTGGTACCCTGTGGAGACGCTTCTGAATCATGCCAGTGAAGAACTGACAGAACGAAGAAAGGTTTTTGTTTTGGATGTGTACAGTCACGGGCAAGATAAAGTGGAAATTATCATCAACAGGGCTTACTAA

Transcript

OS493_032748-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6NSI4	RPA-related protein RADX OS=Homo sapiens OX=9606 GN=RADX PE=1 SV=2
Q8C779	RPA-related protein RADX OS=Mus musculus OX=10090 GN=Radx PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0009950 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF04057 all species →	Rep-A_N	Replication factor-A protein 1, N-terminal domain	Domain	Interproscan
PF17659 all species →	DUF5521	Family of unknown function (DUF5521)	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR040893 all species →	Family	RPA-related protein RADX	Interproscan
IPR007199 all species →	Domain	Replication factor-A protein 1, N-terminal	Interproscan
IPR012340 all species →	Homologous_superfamily	Nucleic acid-binding, OB-fold	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14944 all species →	RPA-RELATED PROTEIN RADX	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003697 all species →	Molecular Function	single-stranded DNA binding	Interproscan
GO:0005657 all species →	Cellular Component	replication fork	Interproscan
GO:0006282 all species →	Biological Process	regulation of DNA repair	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006260 all species →	Biological Process	DNA replication	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_032748-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_032748-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

28.3Max TPM

3.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	4.42	6.75
polyp at pH7 6	18	18	4.37	6.10
coral polyp · control treatment	16	16	5.27	28.35
coral polyp · oil and dispersant treatment	16	16	3.00	18.12
coral polyp · oil treatment	16	16	3.72	6.01
coral polyp · dispersant treatment	16	16	1.99	5.28
Polyp	10	9	2.71	5.25

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.75
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.60
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.60
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.46
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.44
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.20
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.18
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.75
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.45
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.43
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.37
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.32
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.92
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.91
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.71
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.45
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.08
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.92
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.10
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.97
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.76
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.58
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.43
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.18
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.80
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.62
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.54
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.38
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.22
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.00
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.94
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.63
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.54
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.30
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.93
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.75
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.35
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.58
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.34
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.88
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.27
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.56
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.08
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.77
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.39
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.23
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.16
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.70
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.43
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.04
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.35
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.20
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.12
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.53
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.98
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.53
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.44
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.37
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.21
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.92
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.76
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.50
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.47
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.45
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.42
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.41
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.10
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.76
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.01
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.91
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.38
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.83
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.44
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.30
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.80
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.74
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.66
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.60
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.43
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.67
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.60
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.58
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.72
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.78
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.28
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.12
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.59
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.56
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.36
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.36
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.07
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.90
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.63
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.62
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.25
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.07
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.65
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.55
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.51
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.28
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.25
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	4.68
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.35
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.21
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.76
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.73
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.33
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.05
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.70
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.