Gene detail

Detailed information of OS493_032847-T1 in Lophelia pertusa

Genomic Location: scaffold_250:416980...446209
NR annotation: KAJ7370348.1, hypothetical protein OS493_032847 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_032847-T1

ATGCCGAAAACTATCATGGCGCCTTTAGTTAGAATCTTGTCCTTGGGAATAATTATTTTATTAGTGAGTTATTTGGGTAATTCTGCCACAATCAAAGAGCAACAAACTCCTAACAAAGTCGAAGAAGAAAATCTTGGAGAGAATGATGGCAAAACTGCTCAGGATGGCGAACAGGAACAGCTAGAAAGTAATCAAGTACATAAACCCGTTCAAGCGGATAACCAAGGTGAAGAAGAAAAGATTGAAAAGAATACAGACGATCAAAAGTCTCCTGATGCTAAGAGCCAAGGAGCTAAGAAAGATGATTCAGCTAAACTAAGATTTTCAGGCCATCAAAGATTGGATGATGATCAGTCAGATTGCGCTGATGACATCACCCGTCTTTGTTCTGAGATTCCAAAAGGAAACAACTTTGCTTTTCTGATCTGTTTACAGGAGAAAGCCAAGGAAGATGATTTGACTACAGAATGTCATCATATGCTGTGGGAATACAAACAAACATTTTACAAAGATCCAAAGTTTGAAAAAGCAGTGCAAGAGAGATTATGTGTAGATGATTTAAAACGGTTACCTGATTGTCAAAGACCAGGACAGATCATTCCATGTTTGTTAGAAAACAGACAGAATCTGACGGTTCCCTCATGCAAGCATATGATGACCAAAATGCAAACGATTTTCTTCAGCAACTTCCGTCTGATTTCAAACTTTTTGGACGATTGTTCTGAAGATGTGAACAAATACCAGTGTGGTAGGATTCAAACAGAACTGGAAGACGAGGACATCCACTCTCAAAATGACGTACTAGAATGCCTTGAGGAACACCAAGAGGAGTTGTCACAGAAATGCCAGAAGCAAATATACCGACTGGCTGAACTTTCTTCAGACGACTACCACCTTGATCGTCCTCTTTACTATGCTTGTTTAGATGACAGGGAGAGATTCTGTGCAGATATTCCTTCAGGGGAGGGGCGAGTGTACAAATGCTTGAAGAAACACAAGTCTGAGGAAACCATGAGTGATGAGTGTCGAGCAAGGTTGACTGAGCGACAGAAAATGGAGGCCAAGCATGCCAAAGCCAACTATCCATTGATGAAGAATTGCGTGAAGTTTTATCATCAATACAAAGACAAATATGAATGTGAAAAAGGAAACACTAAACATGGAGCCCTGGCAAATATTCTGATTTGCTTGGAGAAAGCTATACAGGATGACCAAAAAGTGAGTGGCAAGTGCCAGGCGGAGTTGTTTGATCTGCGACAACAGCTGATGGAAGATTACTCTATCAATCCTGACATTGTTGCTAAATGCGACTTTGAAATTCAGATGCACTGTCAGAAAGGAACGATGAAGGAAGGGAAAACAATTGACTGTTTGATGGAATTGGCAGAAGAAAACGAGGGAAACAAAGATATTATTAGACCACAGTGCTTTAAGGCTATTGAGGAGCTTTTGAAGGAAACAGGTGCCGGGAGTGATTACCGTATTGATCACACTCTGTACCAGGCATGTGAACCTGTCGTTCAGACTGTGTGTAAAGATAAAGGCAAAAAGGAAGAAGATGTGATGATTTTGTCATGTCTGATGGAGAATCTTCACACAGATAACATGATACCTGAGTGTGAGGAACAGTTGTTGCACCTGGAATTTTTCATTGCAAGAGACTTCACGCTTGATCCTCAATTGCAGAAAGCGTGCAAGAATGACGCTAATGCCATCTGCCAGGCTCCCAGCCTGGAGGATCAAGACACATATCCAGTCAGCTTGGTTATATCATGTCTGTATAGACACATTGTCCTTGAAACACAAACACAGGTTTCACCCAAATGTGCTGCTCATGTTCAGCGTGTGATGCATCAAAGAGCTGTAGATGTGCATTTGATGCCTGAAATACAACATGCTTGTATACAGGATCTTGGAAAACACTGCAGTGATCAAGTCGAAAAGGGAAAGGAGATACAGTGTTTACAGGACAAATTTGACAACTTGACCACTACTTGTAGTGAAGCCATTAGTCAATTTACAGAGGAGGAAGGAGAGGATTATAAGCTTGACAGAACACTGGTGCGTGCTTGCTCTGGCATGTTGACAAAATTCTGTGAGGATATTGTCGCGCAAGGAAACACAGAAGGAGTTCTGCCGTGTTTAGTTGAACACAAAAATGATCAAGGAATGGATGAGAAGTGTCATGCTTCAATTGAGCACTGGCAGCTTGTCGAAATGAAAGATTTTAAATTCTCTCCTGAATTTAAAAAGTCTTGCCGTAAGGATGCCACAAAGTATTGCCAGGACGTGAAGAACAAGCATGACCTTGTTGTTTGTTTGAGTAAAAAGGTCCGTGATGCTGTTATCAATGAGGAGGAACATGTTATTTCTGAGCAATGTCGTAATCACATCAGAATCGAGAAGGAAGAAGAACATATCACTTATGGCCAGGCAAAGATTCTGGCTTGTCTCAGAAACAACAGAGAACAGTTATCAAAGAAATGCAGTGCCCAACTCTTCCAGCGTGAGGAGGAAGAAATGGAAGACCCTGAGTTGGACTACAAACTGAGGCGATCGTGTAAAAAAATGATCAAGATGTTTTGCGATGATGTAAAACCATCAGAGATATTTTCTTGCCTCAGAATGAACAAGAATGATCCATCCATGGATGATAGTTGTCGTGCCATAGTCACCAAGAGACAGATCAGACAATCAAAAGATGTTAAACTCGATCCACAGCTGCGTCAATTCTGCAAGTTAGACATTCCTAAATTTTGCCAGGAGGAGATGGATTCTCATGGTCAAGGAAAAGTTGTCAAGTGCCTGAAGGATCATTATGATCGTTTGTCCGATGAGTGCATAGACTACGTCAAAAGGCTGATGCGTGAGGCTGCACGTGACTACAGGATGGATGCCAGGCTGTCCAATGAGTGTGCAGATGATATCAAAAAGTATTGTAGTGATGCTGCACCATCTGCAGTTGAGGAGTGTCTCAAAAGTCATTTAGGATCACTTGCTTCAAAGAATTGTCGAGTGGAGGTAGTCCGTCAAATGAAGGAAGCCCGCACAGACATACAGTCCGATCCTGTGTTATTCAAGGCATGCGCAGTGGATGTCAAACGTCACTGTTCAGAGATACCGTTTGGACGCGGAAAAGTAATGAAGTGTCTCCTGGAGGCTCACGACTCGAACCCAGCTCGTTTTGATAGAGAATGCCTGCTCCATTTGGCAAGCCGGATGAAGATGTGGAAACTAGCTGCTATAAAGTTTGTCCCTTCTGAAACTGTCGGTGATCTTGCTCTTTCCATCACCTCGTCATCCTCGTCATCCAAGAACTACTATTTTGTCATTTTCGCATCTTGCTTGGCGCTGATTTTTGTTGGCGGATTGGTGTCACATCGTTGTCACATCGTTAATAACAGACCAAGAGTGTTTGTTATTTGA

Transcript

OS493_032847-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q9Z1E9	Golgi apparatus protein 1 OS=Cricetulus griseus OX=10029 GN=GLG1 PE=1 SV=1
Q61543	Golgi apparatus protein 1 OS=Mus musculus OX=10090 GN=Glg1 PE=1 SV=1
Q62638	Golgi apparatus protein 1 OS=Rattus norvegicus OX=10116 GN=Glg1 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002302 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00839 all species →	Cys_rich_FGFR	Cysteine rich repeat	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR017873 all species →	Repeat	Cysteine-rich Golgi apparatus protein 1 repeat, eukaryote	Interproscan
IPR039728 all species →	Family	Golgi apparatus protein 1	Interproscan
IPR001893 all species →	Repeat	Cysteine-rich Golgi apparatus protein 1 repeat	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11884 all species →	SELECTIN LIGAND RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000139 all species →	Cellular Component	Golgi membrane	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K06816	GLG1, ESL1; golgi apparatus protein 1	-	Cell adhesion molecules	ko04514	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_032847-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

71.3Max TPM

22.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	15.45	31.11
polyp at pH7 6	18	18	14.77	26.44
coral polyp · control treatment	16	16	32.85	71.34
coral polyp · oil and dispersant treatment	16	16	27.30	46.05
coral polyp · oil treatment	16	16	28.47	49.91
coral polyp · dispersant treatment	16	16	22.11	40.34
Polyp	10	10	10.23	19.03

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.11
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.24
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.84
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.54
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.45
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.25
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.28
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.86
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.34
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.20
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.16
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.69
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.50
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.36
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.79
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.58
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.97
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.88
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.44
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.31
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.76
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.16
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.44
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.12
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.15
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.64
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.77
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.78
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.69
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.50
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.43
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.43
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.68
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.66
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.04
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.79
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	71.34
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.12
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.33
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.85
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.03
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.10
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.46
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.01
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.43
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.87
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.31
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.72
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.57
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.67
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.91
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.92
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	46.05
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.01
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.48
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.94
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.71
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.37
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.03
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.10
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.95
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.92
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.76
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.70
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.38
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.08
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.64
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.68
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.91
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	46.01
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.94
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.78
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.74
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.10
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.67
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.67
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.93
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.02
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.96
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.12
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.17
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.17
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.47
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.92
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.34
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.91
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.94
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.48
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.33
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.31
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.28
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.19
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.70
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.88
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.56
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.82
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.31
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.88
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.45
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.45
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	19.03
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	15.91
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	12.76
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	10.39
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.73
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	8.73
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.85
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.64
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.42
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.85

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.