Gene detail

Detailed information of OS493_032930-T1 in Lophelia pertusa

Genomic Location: scaffold_251:501285...515519
NR annotation: KAJ7352991.1, hypothetical protein OS493_032930 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_032930-T1

ATGGACGAGGGTAGAAATAACATGCATCAACAGCAGTTCAAATTGCCAAAGAGGAACACACAGAGCCCGCCAACTTCACCTGCATATGTCGGAGAATACTGTTCAACTGGTCCCAAGCTGGAAGATCTTTACAATGAATTGGATCAGCTAGAACTTGACCCACCCACTGGAGCTTCAGATGAAATACCTGCGGCATTGAGAGAAGAGGATGCCGCACACATTTTTGAGAATTATTCCTTTGATCACACTTATTCTCCAGATCTTCCTATTACACGTTACCGACAGCAAATTGTTGATACCATTGAGAGTAATTCAGTCACTATTGTGCAAGGGGCCACTGGTTGTGGAAAAACGACCCAAGTTCCACAGTATATACTGGACGAGTATGCCAAGGACCAGCGGTACTGTAATATTATTGTCACGCAACCAAGACGTATTGCTGCGATAAGCATCGCCAAACGAGTTTGTCAGGAAAGGGGTTGGACATTAGGCAGTTTGGCTGATTCAAGCCAAGAACATGAATCAATACACGCATGTTTTCTGGATGAGGTTCATGAACGTGATCAAAACTCCGACTTCTGTCTCCTGGTGGTGAAAAAGTTGTTGAGAACAAACTCAAGGCATGTGAAGGTTGTCCTAATGTCAGCCACCATTGAAAGCGATCTTTTCTCCATGTATTTCGCTGTACCTGTGCGCGGCAGGGTAGAGGGCGCCCCTGTTGTCACTGTAGAGGGCAAGTCCTTCCCTGTGGTGGAAAGTTATCTTGACGAGCTTCGAGATGTTGGAATGATTCCAGATAACACTCTTGAAGAGCCAGGTATCGACAAGGTTGGATATCAGCTGGCAGCTCGATTAATTCGCCATCTTGATGAACTGGAGAATTTAAGTTCTCTAAGACCAGAAGAGCAAGGTTATCGTGGGACAGTCCTTATGTTTTTCCCTGGTATTTTTGAAATCAGACAGATGGATCAGGTGTTAGATGACATGTGCGAAGATTGCAGGCTGTTGATACTTCCACTGCATTCCCAAATCACTACTCAGGAGCAAGCAGATGTTTTTCAGAAGCCTCGAGATAATTATAGAAAGGTCATCTTGTCTACAAACATTGCAGAAAGTTCAATCACCGTTCCCGACATCAAATATGTCATTGATTTTTGCCTGGAGAAGTGTCTGATATGTGATCCAGAGACAAACTTTCAGAGTTTACGGCTGCAGTGGTTATCCAAGGCCAATGCTACTCAGCGCAAAGGTCGTGCTGGCCGTGTGTCATCTGGGACATGTTTTAGAATGGTGACCAAAGAATTCTATGAATCTTGTCTTCCAGGATTTGGTATTCCTGAAATGCAGAGATCTCCACTGGAACAGCTTGTGTTGCAAGTAAAGCTCTTAGATATTGGACCTCCCAAGGCAGTACTCAGACTGGCTTTACAACCTCCAGATTCAGACGACATTGAACGAACAGTCTTGTTATTGAAACAGGTTGGTGCCCTGACTATCGTCATGAAGAATGGTACAATCAATCCTTGCGATGGTGAACTGACATTTATTGGCAAAGTGTTGGGTAATCTGCCGATTGATGTTCATCTCGGAAAGCTGTTAGTGCTGGCGTATGTGTTTGGATGTCTGGAGGAGTGCCTTGTTATCAGTGCAGCACTGTCTCTGCAGTCGTTCTTTGCAAATCCCTTTAGAAGGGAGTTTGATGCTTACAGTAAGAGGATGGCTTGGAGTGATTACTCGCACAGTGACTGCATTGCAGCTCTCAATGCTTTCAAGGAGTGGAGCATGATGAAACGACGAAAAGGATTCCCAAGGGGTGAAATAAATTGGTGCAAAGATAACATGATACAGCCAGGTCGCATTCGAGAGGTTGAAGAACTTGTCAATGAGTTGACAGACAGACTCAAGCAACTCAATCTCAGAACAATTCGACCTCTGCACCAGAAGGCAAGCAATTCTCAGGAGTCTCTGCTCATTTTAAAGCTTGTGATCTGTGGAGCATTTTATCCAAACTTCTTTGCATCAAGTGATATCGATGAAGCTGAAGCAATGAAAGTGATGTCTGGCCATGATCCTTTTAGCACTGTTATGGTCAGGAATATGCCTCACCATGGTGCACTTTACCGATCACAAATTGCAAGAATGTTCAGGCAGTGCGGCAAGGGCAAAGCTCTTTTCTTTGAAGAAAGCAGGGCCTACATTGAGTTCGAGAGGCCACGTGACTTTGATCGAGGTTCACAGTCCACTTCAGTTGTACCAGCTGTCTACAAGGCCATTAAAATGAGACATCTGCGGCTTCCCTCAATCTGTTCATTTCTGAAGCTAGAAATGCTGAAATGGACAGAAGGATGGAGGAGAGGAATAAGGAATATTTTGATCAAAGCGGAGAACCTACCAGAACCAGACTCAGGACGAGCAGGATGGCTACAAATCTGTCATCAAGAGGGGCGGGTAGAGTGGAGCTTATGGAGGAACCACAGCAGGTTAACCTTCCTCCGACCGGCTACTTAG

Transcript

OS493_032930-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8NDG6	ATP-dependent RNA helicase TDRD9 OS=Homo sapiens OX=9606 GN=TDRD9 PE=1 SV=3
Q3MHU3	ATP-dependent RNA helicase TDRD9 OS=Rattus norvegicus OX=10116 GN=Tdrd9 PE=2 SV=3
Q14BI7	ATP-dependent RNA helicase TDRD9 OS=Mus musculus OX=10090 GN=Tdrd9 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003306 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00271 all species →	Helicase_C	Helicase conserved C-terminal domain	Domain	Interproscan
PF21010 all species →	HA2_C	Helicase associated domain (HA2), ratchet-like	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR001650 all species →	Domain	Helicase, C-terminal domain-like	Interproscan
IPR014001 all species →	Domain	Helicase superfamily 1/2, ATP-binding domain	Interproscan
IPR007502 all species →	Domain	Helicase-associated domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR18934 all species →	ATP-DEPENDENT RNA HELICASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003723 all species →	Molecular Function	RNA binding	Interproscan
GO:0004386 all species →	Molecular Function	helicase activity	Interproscan
GO:0005622 all species →	Cellular Component	intracellular anatomical structure	Interproscan
GO:0010529 all species →	Biological Process	obsolete negative regulation of transposition	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_032930-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_032930-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

24.1Max TPM

7.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.09	15.71
polyp at pH7 6	18	18	8.11	14.60
coral polyp · control treatment	16	16	9.77	24.11
coral polyp · oil and dispersant treatment	16	16	6.30	13.99
coral polyp · oil treatment	16	16	7.94	13.72
coral polyp · dispersant treatment	16	16	7.62	15.81
Polyp	10	9	3.65	7.69

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.71
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.54
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.04
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.89
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.65
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.01
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.93
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.89
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.61
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.42
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.25
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.80
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.73
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.09
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.72
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.46
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.76
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.07
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.60
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.62
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.38
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.32
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.19
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.63
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.87
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.43
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.94
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.77
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.94
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.84
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.83
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.93
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.93
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.58
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.84
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.28
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.11
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.75
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.21
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.82
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.18
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.60
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.28
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.64
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.18
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.06
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.90
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.74
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.33
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.57
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.06
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.85
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.99
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.71
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.27
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.99
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.86
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.58
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.25
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.14
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.77
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.61
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.07
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.59
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.35
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.28
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.19
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.10
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.72
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.12
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.99
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.76
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.66
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.56
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.00
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.97
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.32
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.03
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.81
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.32
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.85
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.83
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.92
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.11
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.81
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.12
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.34
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.44
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.71
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.69
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.54
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.05
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.82
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.76
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.28
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.77
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.17
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.87
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.08
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.52
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	7.69
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.34
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.29
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.14
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.77
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.84
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.69
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.16
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.61
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.