Gene detail

Detailed information of OS493_033047-T1 in Lophelia pertusa

Genomic Location: scaffold_254:294525...307141
NR annotation: KAJ7382761.1, hypothetical protein OS493_033047 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_033047-T1

ATGAGTGATTTGGACGAGGCTGCGATTAAGAAGCTCAAGGTAGCAGAATTACGAGCAGAATTACAAACGCGAGGTTTAGATTCGAAGGGGAATAAACCCGTGCTAGTCGAGCGCTTGCTCGAGGCGATTTCAACGGTCACTGCAGAAAACGGCGATGAAGCTATGGAAGAAAGCGTCGCGGAACCTGAAGAAGGTGCCGCAGAAGAGAAAGTAGAACCTCCTGCTGAAGAAAATCAAGAAGACGGTGACGAAAAAGAAGAAGCGAAGGTGGAAGAAACATTGCCGGTGAGCGAAGATACCTCGGTGGACAAAGACGCCGTCCCAGAAGAAAAACCTTCCGAAGATAAATCTCAGGTGACAGATCAAGCTCCTGAAACGGCTGAGAAAGAAGAAAGTGCAGCAGATAAGAAAGAAGACGTTAAACAAGCAGACGAACCAATGGAGACGGACAAAGAAGCTGGATCAACAACACAAGGAACCGAAGGAGATAAAGAGAAAGACGGTGATGACGATGTAAAGATTGACGCAGAGGCCAGTGTTGAACCTGAGGAAGAAGAGATTCAGCTTGACGACTCGTTAGTCGTCTTGGATAAATACATTTGCGACTTGCATCTAAAAGTTGCCCCAGATGGTCTGAGTGGAAAACCATTGGAGGATGAAGGGTTTTCCTATCTCCTTGCTGGCGCTAAAGCTACCTGGGGTGTTACAAAAGGAAAAGTCTGCTTTGAATGCAAGGTGACATCGTTTGTGTCTGTAGAGCTGCCTGAAGCCGAGGATCCCAAGAATGTGGTGAGAATTGGCTGGTCAACTGATGCTGCCAGTCTTCAGCTTGGAGAAGACAAGATATCATACGGTTATGACTCATCTGGCAAGAAAGCGCTTGACTCAGAGTTTACAGACTATGGACAAACATTTGGTGCTGATGATGTAATTGGGTGTTACTTAGACTTGGAGAGTGATCCGAAGACAATTTCATTCAGCAAGAATGGTGAAGACCTTGAAGTAGCCTTTGAACTGACTGAAGATCTGGAAGAAAAAGCACTTCACCCTCACATACTCGTCAAAAATGCTGAGTTTAGCGTCAACTTTGGATCTCAGGAAGAGCCATGGTTTCCAGCAAAGGAAGGGTACACTTTCATGCAGTCTGTTGGTGAAGAGTCGTTGGTACACGGCACACGAGGACCTACAACTAAGAAAGAATGCGAGGTTATCATGATGGTTGGATTGCCCGGATCAGGGAAAACCACTTGGGTTAGTACGAAAGTCAGCGAAAACGCAGACAAGAAATACAATGTGCTTGGAACAAATTCTATCATGGAGAAAATGAAGATCTTGGGCGTGGCCAGGAAGAGAGATGTGGGTGGTTACAGCAAATTGATGGACAAGGCGGCAAAATGTCTGCACCGCTTGTTTGAGCTGGCTCCAAGTAAAAAGAGGAATTACATTCTGGACCAGACCAATGTGTACCTTTCAGCTCAAAAGAAGAAGATTCGACCTTTTGAAGGATTTAGCCGCAAAGCTATTGTGTGTATTCCCAGTCAAGAAGAACTTAAAAAGAGAACAGAAGATAGAAAGAAGGAAGGCATTGAGCTGCCTGAGAACGCTGTCAGTGACATGAAAATGAGTTTCACTCTCCCCAAAGTTGGAGAATTCTTTGAGGAAGTCGTGTATGCCGATGAGCCTGAAAGCAACTCTAAAAGCATTGTTGATGAATACATCAAAGAAGGTCGCTCTTACAGAAGCCGCTCAGGTTCCGGGTCAGAACCTCCTTACAAACGCTCAAGATTTGAGGACAGGTCTCCTAGACACGGTGGAGGAGGGGGAGGAGGGTACAGGGATAGAAGCTATGATGACCGTGGAGGTTACAGACGGGGTGGTGGAGGAGGAGGCTCTTACCAGCGGTTTGGAGGCCGATCATATGGAGGAGGAGGAGGCGGTGGATACCGCGGAGGACGTGGTGGAGGAGGAGGGTACAATGACAGGAGGGACAATCGTGGTGGAGGGAGAGGTGGAGGGGAAGTTACGGTGGTGGTGGTGGAGGTTACCGCCAGCAGCAGTCTTCATACCGTCAAAACCAGCAATCCAGTCAGCAACAGAGACCTCGCTACCAGCAGAATTACACCCAGCAACAACAGCAGACCACTACACAGGCATCATACACTCCACAACAACAACAGTATGGCACTAGCGCAGCGTATAACCAGTACTACAACTATAACCAGGGATACCAGGCCACCACAGGCTACCAACAAGCAGGTTACACCCAGCAGCAGGGGTATGGCCAGACAGCGCAGCAACCCGCAGCGGCATACCAGAATTACCAGAATTACTACGCCGGCTATCAACAACAACAACAACAACAACAGCAGCAGCAACAACAGTATGGAAGTTATGGCAGCAGTGGTAGCGGGTATTAGATTGTCTGTTGGACATTGTCTGGAGAAAATGAAGTGCGACCTTGTATTATGGAAGTGTGTTAGTTAG

Transcript

OS493_033047-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8VDM6	Heterogeneous nuclear ribonucleoprotein U-like protein 1 OS=Mus musculus OX=10090 GN=Hnrnpul1 PE=1 SV=1
Q9BUJ2	Heterogeneous nuclear ribonucleoprotein U-like protein 1 OS=Homo sapiens OX=9606 GN=HNRNPUL1 PE=1 SV=2
Q00839	Heterogeneous nuclear ribonucleoprotein U OS=Homo sapiens OX=9606 GN=HNRNPU PE=1 SV=6

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001454 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00622 all species →	SPRY	SPRY domain	Family	Interproscan
PF02037 all species →	SAP	SAP domain	Domain	Interproscan
PF13671 all species →	AAA_33	AAA domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR043136 all species →	Homologous_superfamily	B30.2/SPRY domain superfamily	Interproscan
IPR003034 all species →	Domain	SAP domain	Interproscan
IPR035778 all species →	Domain	Heterogeneous nuclear ribonucleoprotein U, SPRY domain	Interproscan
IPR013320 all species →	Homologous_superfamily	Concanavalin A-like lectin/glucanase domain superfamily	Interproscan
IPR001870 all species →	Domain	B30.2/SPRY domain	Interproscan
IPR003877 all species →	Domain	SPRY domain	Interproscan
IPR036361 all species →	Homologous_superfamily	SAP domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12381 all species →	HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN U FAMILY MEMBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_033047-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_033047-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

109.1Max TPM

64.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	57.72	80.71
polyp at pH7 6	18	18	57.28	77.21
coral polyp · control treatment	16	16	83.25	109.08
coral polyp · oil and dispersant treatment	16	16	69.26	93.22
coral polyp · oil treatment	16	16	76.66	103.18
coral polyp · dispersant treatment	16	16	58.13	108.68
Polyp	10	10	43.13	67.04

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	80.71
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	79.26
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	71.34
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	70.88
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	69.32
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	67.79
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	63.70
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	63.37
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	53.92
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.30
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.24
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.00
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	49.59
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.87
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.36
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.04
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.45
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.73
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	77.21
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	73.78
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	72.91
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	71.91
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	67.85
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	65.83
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	62.05
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	59.05
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	54.86
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	53.39
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	51.19
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	50.15
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.18
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.11
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.87
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.70
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.99
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.06
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	109.08
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	103.01
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	101.20
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	100.89
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	98.86
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	95.24
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	91.38
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	86.49
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	84.83
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	83.37
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	79.40
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	72.77
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	67.73
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	64.26
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	63.13
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.41
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	93.22
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	86.54
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	84.11
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	83.21
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	80.31
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	77.41
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	73.16
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	68.18
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	67.63
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	66.96
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	63.20
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	62.27
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	58.55
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	52.52
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	49.53
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.33
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	103.18
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	96.86
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	95.75
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	90.95
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	86.44
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	83.80
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	80.61
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	80.21
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	75.56
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	73.59
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	71.92
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	68.23
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	66.44
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	64.32
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	52.80
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.88
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	108.68
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	104.84
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	74.13
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	66.69
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	65.86
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	63.79
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	60.19
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	57.94
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	57.31
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.91
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.76
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	55.02
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	47.08
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	32.97
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.46
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.42
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	67.04
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	61.63
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	60.38
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	57.26
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	54.00
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	40.05
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	28.07
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	24.54
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	20.57
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	17.75

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.