Gene detail

Detailed information of OS493_033526-T1 in Lophelia pertusa

Genomic Location: scaffold_267:232464...257515
NR annotation: KAJ7376644.1, hypothetical protein OS493_033526 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_033526-T1

ATGTCAGAGCAGAACAAATCGCACGACAAGTTCAGATTTGCCATCGACCGTGGCGGGACGTTTACCGATGTTTATTCAGAATGTCCAAACGGAGAGGTTAGAGTGATGAAGCTACTGTCTGTGGATCCTGCATATCCTGATGCTCCAAGGGAAGGAATAAGAAGAATTCTGGAACAGGTGACAGGAGTAAAGATGCCGGCAGATCAACCAATCGATCCCAAGTACATTGAATGGATCAGGATGGGAACTACAGTGGCTACAAATGCTCTGTTAGAACGGAAAGGAGATAGAATGGCTCTTGTCATTACAGAAGGATTCCATGATCTGCTGCACATTGGCAACCAAACAAGACCAAATATATTTGATTTAAAAGTAATATGTCCGGAGGTGTTACATGAAGATGTTGTAGTCGTCAAAGGAAGATTGGTTTTAGTACAAGATGGCAGCGAGATTCAAAGACCGGAAAACTATAAAATAGTTGCTGGAAGTACTGGAGAAAAGCTTGAAGAGTGGGAATCATTGGACAAAGAGCAACTTAGAAAAGATCTCCAGAGAGTTCTTGACAAAGGAATCAAGAGTTTGGCTGTTGTACTGATGCACTCGTACATGTATGACGTACATGAGAAAGAAGTTGGTAAAATAGCTCTAGAGATGGGTTTTGATCAGGTGTCACTGTCTTCTACAATAATGCCCATGGTTAGGATTGTGCCTCGTGGATACACAGCTTCTGCTGACGCTTATTTGACTCCCTGCATAAAGAAATACATCCGTGGCTTTACAGCTGGTTTTCAGGAAGGCATTCAGGACAAAGTGTTGTTTATGCAGTCTGATGGTGGTCTGACTCCTGTAGCAAAGTTTTATGGATCAAGGGCCATTCTTTCTGGACCTGCAGGTGGTGTGGTTGGTTATGCAATGACAACGTTTCAGAGAGAGACTGATCAGCCAGTTATTGGATTTGACATGGGAGGAACATCAACCGATGTGTCTCGCTTTGCTGGTCAATTTGAACACGTGTTTGAGACAACAACAGCTGGAATCACAATACAGGCACCCCAGTCGGCCAGTGCCCATCCAGGACCTGTGTGTTATCGGAAAGGTGGTCCACTGGCTGTGACAGACGCAAACCTGGTGCTTGGCAGAATTCTACCCGAATTTTTCCCAAAAATCTTTGGAAAAAGTGAAGACTTGCCGTTAGACTTGGAAGGTTCATGGTCAGCTTTCAAGAAGTTAACAGAAGAGGTCAATGAATTTCTGTCGTCTCAAGATGACGGTGCAAAGAAAGATCCTCTGAGTGTGGAGCAGGTTGCCATGGGTTTCATTACCGTTGCCAACGAGACCATGTGTCGACCAATCAGAACCCTGACTGAGGCGAGAGGTCACGACACTGCTCGTCACGTTCTGGCGTGTTTTGGCGGGGCAGGCGGTCAGCATGCTTGTTCCATTGCTAGGTCGTTAGGAATGTCTACTGTGTTTATTCACCGCTTTGCCGGTATCCTGTCAGCGTATGGACTGGCACTAGCAGATGTGGTGCACGAAGCACAGGAACCCTGTGCACGTGTTTATAATAAAGAGTCGTTTGGATATCTGGATGGGAGGATTGATCTTCTGACGCAAAAGTGCGTTGAGGAACTGAAAAGCCAAGGATTTGAAGAGAGTCAAATCTCCACTGAAGCATTTCTTCACATGCGATACAGTGGTACGGACTGCGCTCTTATGTGCACTGCTGTTCCTCGGAAAGAAACTCAGCCAGGGGAAGGTTGTCGCCATGGTGATTTTGGACAAGCTTTTAACCAAAGATACATCCGGGAGTTTGGTTTCACCATTCCTAACCGACAGATCATTATTGATGACGTCAGAGTGAGAGGGACTGGACACTCTAAGACGTCCGTAGCACATGAAGTGCCAACAGCCAGCACCCCTCCCCCTGTGAAAAAGACAACAAAGTGTTACTTTGAAGATGGTTTCCACGACACAAACATTTACCTGCTTGAGGAGATGTCCGCTGGCCACACCATAGATGGACCGGCTATTATCGTGGACAAAAACAGTACTATGCTTGTTGAACCACAGTGTAAAGCTTCTATCACCGTGTCGGGAGATATCAGGATCGAGATTGGAGGAAACCAAGGCAAAAAGAGTATTGGAACGGAATTGGATGCCATTCAGCTGTCTATATTTTCTCATCGTTTTATGAGCACCGCTGAACAGATGGGACGAGTTCTTCAACGCACGTCAATTTCAACTAACATCAAGGAGCGACTCGACTTCTCTTGCGCCATGTTTGGTCCTGATGGAGGCCTGGTTGCCAATGCTCCCCATATCCCAGTCCACCTCGGTTCCATGCAGGAAACTGTACAATACCAGATTCGCACTTTGGGAGATGATCTGAAGGAAGGTGACGTCATACTTAGTAACCACCCGAGTGCCGGGGGGACACATCTTCCAGATCTAACTGTCATCACTCCGGTGTTTTATCCCGGCCAACCTAAACCCGTGTTCTTTGTTGCGAGCCGTGGTCATCACGCCGACATTGGAGGTTCTGCGCCAGGGTCCATGCCACCCAATTCTCATTCCATATTTGAAGAAGGAGCCGTGTTCAAGTCATTTAAAGTTGTGAAACAAGGTGTCTTCCAAGAAGAAGCACTGATTGAGAAGCTGATGGACCCCGCAAAGTATCCCGGATGTAGTGGCACGCGCAATCTCCATGACAACCTCTCTGACCTCAAAGCCCAGGTGGCGTCTAATCACAAGGGAATCAAGTTGATTACTGGCTTGATAGAAGAGTACAGTTTGCCAGTGGTACAGGCTTACATGAAGTACATTCAGCACAATGCTGAAGTTGCTGTTCGGGAGATGCTGAAGGAAATCGCTGCGAAAACTAAGGAACGCACTGGAAAAACAATCTTGTCCTCTGTGGATCACATGGATGATGGCTCGTGCATCAAACTGACGATATCCATTGATGAAAAGGAGGGCAGTGCAGTGTTCGATTTCACGGGAACTGGGCCCGAGATGTACGGTAACTGTAATGCACCTCGCGCCATCACCTTCTCCGCTATCATCTACTGTCTGCGGTGCATGGTCAAACACGCTATACCGCTGAACCAGGGTTGTTTAACGCCAGTGAAGGTGATAATCCCGCCTGGCAGTGTACTGGATCCAACAGAAACCGCGGCAGTTGTTGGCGGGAACGTGTTGACCAGTCAGCGAGTTGTCGACGTGGTGTTGAAAGCCTTTGAAGTGTGCGCTGCATCACAGGGCTGCATGAACAACACAACATTTGGTGACGAGGGATGCGGCTACTACGAGACAATCTGCGGGGGGTCTGGTGCGGGTCCAACGTGGGACGGACGGAGTGGAGTTCATGTTCACATGACAAACACTAGAATAACAGATCCGGAGATCATCGAAAGAAGGTTTCCAATAATTTTGCGCCGTTTTCATCTCAATCCCGGCACTGGTGGAAATGGTTTTCACAAGGGCGGTGATGGTGTTGTGCGCGAGTTGTTGTTCAGGAGAGCGCAGGTTCTTTCTGTTCTCGGTGAGAGGAGAGCATTCAGGCCTTACGGAATCAAAGGCGGTGACCCAGGGTCTCCGGGTTTAAGCCTGCTGTTGAAGGCGGATGGTCGAATAATCAATCTGGGAGGCAAGGCGTCAGTCAACATGAAACCCGGGGACTGTTACCGTGTCCAGACTCCTGGCGGTGGTGGATACGGAGTACCAACAGGAAGCCTGGGACAGACAAATGACGTCGGTGATCCGCCGTCAAGAGGTGAACAGGAACAACCACAACACTTTGCAGCCTGCGGGAGTTTACACAACTACAAGATGATGCAAGAGTCGGCATAA

Transcript

OS493_033526-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q75WB5	5-oxoprolinase OS=Bos taurus OX=9913 GN=OPLAH PE=1 SV=2
O14841	5-oxoprolinase OS=Homo sapiens OX=9606 GN=OPLAH PE=1 SV=3
Q8K010	5-oxoprolinase OS=Mus musculus OX=10090 GN=Oplah PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001799 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF05378 all species →	Hydant_A_N	Hydantoinase/oxoprolinase N-terminal region	Family	Interproscan
PF02538 all species →	Hydantoinase_B	Hydantoinase B/oxoprolinase	Family	Interproscan
PF01968 all species →	Hydantoinase_A	Hydantoinase/oxoprolinase	Family	Interproscan
PF19278 all species →	Hydant_A_C	Hydantoinase/oxoprolinase C-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR008040 all species →	Domain	Hydantoinase/oxoprolinase, N-terminal	Interproscan
IPR003692 all species →	Domain	Hydantoinase B/oxoprolinase	Interproscan
IPR045079 all species →	Family	Oxoprolinase family	Interproscan
IPR002821 all species →	Domain	Hydantoinase A/oxoprolinase	Interproscan
IPR049517 all species →	Domain	Acetophenone carboxylase-like, C-terminal domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR11365 all species →	5-OXOPROLINASE RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003824 all species →	Molecular Function	catalytic activity	Interproscan
GO:0005829 all species →	Cellular Component	cytosol	Interproscan
GO:0006749 all species →	Biological Process	glutathione metabolic process	Interproscan
GO:0016787 all species →	Molecular Function	hydrolase activity	Interproscan
GO:0017168 all species →	Molecular Function	5-oxoprolinase (ATP-hydrolyzing) activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K01469	OPLAH, OXP1, oplAH; 5-oxoprolinase (ATP-hydrolysing)	EC:3.5.2.9	Glutathione metabolism	ko00480	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_033526-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

46.3Max TPM

10.7Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.51	21.20
polyp at pH7 6	18	18	11.70	16.50
coral polyp · control treatment	16	16	12.70	41.47
coral polyp · oil and dispersant treatment	16	16	9.35	17.62
coral polyp · oil treatment	16	16	11.17	28.15
coral polyp · dispersant treatment	16	16	10.90	46.27
Polyp	10	10	5.10	13.29

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.20
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.60
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.97
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.15
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.09
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.82
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.11
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.55
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.07
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.69
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.93
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.83
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.90
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.57
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.70
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.60
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.40
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.01
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.50
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.27
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.80
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.68
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.56
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.30
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.29
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.24
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.21
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.90
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.06
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.37
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.31
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.64
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.38
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.38
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.28
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.45
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.47
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.34
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.29
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.26
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.16
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.12
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.65
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.62
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.51
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.20
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.59
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.84
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.15
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.01
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.15
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.87
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.62
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.98
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.60
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.61
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.41
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.85
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.69
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.62
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.28
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.27
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.71
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.32
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.90
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.69
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.07
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.01
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.15
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	26.23
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.49
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.41
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.23
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.11
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.64
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.60
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.59
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.35
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.94
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.55
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.29
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.43
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.51
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.21
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.27
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.58
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.79
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.46
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.97
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.36
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.11
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.39
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.92
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.69
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.78
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.49
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.22
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.43
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.39
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.57
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	13.29
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	8.17
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.39
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.62
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.48
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.15
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.97
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.73
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.01
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.18

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.