Gene detail

Detailed information of OS493_033550-T1 in Lophelia pertusa

Genomic Location: scaffold_267:466866...488859
NR annotation: KAJ7376668.1, ATPase, P-type (transporting), HAD super, sub IC [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_033550-T1

ATGGCTTCCGTGACTCGACTTATTGCTCTTGGAATTGGTATTTTTATTTGCTGTTTTCAAAGTGTTATCGGAAGACAACCGCATATTGTCTTTATTTTAGCAGATGATTATGGTTTTAACGACGTCGGATACCACAATCCACGCATAAAAACTCCGAATCTTGACAGTTTGGCTGCTGGTGGGGTGCGCCTGGAAAATTATTACGTTCAACCAATTTGCACCCCAACCCGAAGTCAGTTGTTTTCTGGCAGATATCAGATTCACACTGGCCTGCAACACGGGATCATCTGGCCTTCCCAGGCAAATGCACTGCCCAAGAATGATACTACAATTGCCACTTACCAGGCTGTTCATTCACCACTTGAGGTACCTGCACAGTACACAGAGCAGTACAAAGATATAGACAACTACGCTCGCCGAACATATGCAGGCATGGTTAGCTGTATGGACGAAGGGATTGGAAACATAACACAAGCTCTACAGAAGCATGGCTTGTGGGATGACACAGTACTATTTTCAGTACTGACAATGGTGGTCAAATATATTCTGGCGGCAATAACTGGCCATTACGCGGCTGGAAAGATTAACATGGAAATGATCCATGTCACCGACTGGCTTCCAACAATTGTCCACCTGTCGGGAGGATCTGTTGACAGCATGCCTTTGGATGGTTACAATGTCTGGGAAACATTGAGCAGTGGAGAACCCTCGCCAAGAACGGAGATATTGCATAATGTTGACCCTATAGATGCTTATTGGGACAGCCACTTTGAGTCTTATCATCACTGCCGACAAGCTGCCATACGAGTTGGCGACTGGAAACTTTTGACAGGTTGTCCAGGAAATGGGAGTTGGATTCCACCGCCAGAGAGTTCCTATCTGTTTGAGCATGGACCAAATTACCATGACAACATCAACAGCACCTTTCTTTTCAACATAAGAGAGGATCCTGAAGAACGAAATGAACTATCTGCGGTATATCCAGATAAGGTGGCTTTCTTGATGCAGAGGATCAGGGAATACAATGCAACAGCTGTACCAGTACGTTACCCAGATCCAGATCCTGCGTCATTACCAGAGCTGCATGTTTTGAAACAATTTCGGAGTGATCCTGTACGCGGTTTGACACACGATGAAGTCGAGAGGCGACGGAAGCTACATGGGTTAAACGAATTTGATCATGTAGAGGAAACGCCGCTCTGGAGAAAATATATTGACCAGTTTAAAGAGCCTATGATTGTGTTACTGCTGGCTTCAGGCCTGGTTAGTGTAACTATGGGTCAGTATGATGATGCTGTTAGCATAACAGTGGCCATAATAATAGTTGTTACAGTAGCATTTGTCCAGGAATACCGTTCCGACAAGTCAGTAGAAGCCATCAAGAAACTTGTCCCACCTGGCTGTCATTGTATACGCGAAGGCCAAGTATCAGATTTTTTGGCTCGCAGTTTAGTTCCAGGAGATTTAGTCACCATATCAGTAGGAGATAGAGTTCCAGCAGATTTAAGGCTAATTGAGGCTGTAGATTTAAAAATAGATGAATCAAGTTTTACTGGTGAGACTGAACCAGCAACTAAGACAACAGATATGATTCCTCCATCCAAATCAAGTGGAGGCATCTCACAAAGAAGAAATATCGCTTTTATGGGCACTTTAGTCCGCTGTGGCCGTGGCAAGGGTATAGTCACTGGAACTGGTGAAAATTCAGAGTTTGGTGAAGTGTTTAAAATGATGAAAGCAGAGGAACCTCCAAAGACCCCACTTCAAAAAAGCATGGACATCTTAGGAAAACAATTATCTTTTTATTCTCTTTGTATTATAGGTCTTATTATTCTTTTGGGTTGGCTACAAAAGAGAGGCATTCTAGAGATGTTTACCATTGGAGTCAGCTTGGCAGTAGCTGCCATCCCAGAGGGTCTTCCTATTGTAGTCACTGTTACTCTGGCACTTGGTGTAATGCGGATGGCCAGAAGAAATGCTATTGTAAAAAAGCTACCTATTGTGGAGACTCTTGGGTGTGCTAGCGTTATTTGTTCGGACAAGACCGGTACACTTACCAAGAATGAAATGACAGTAACGCAGATATTCACTGCCGATGGACACTATGCAGAGGTTTCAGGAGTAGGGTACAATGGGTGTGGTCATGTAACCATCGCAGGCCAAACTCTAACACCAAACAGCAACTTGTCCATTACTAAGGCCATGGAGCTTGGTATTAATGACCCAAGAAGAATGTACACACGCACAGAAGAAATCTCTTTTAGCTCCGAGAAGAAGTGGATGGCTGTTAGGTACAGAAGACAGGACAATTCAGAGGTGTATTACGTGAAGGGAGCACCTGAGAAGGTGTTACAGCAGTGTACATCATACAGCAGACAAGGCTCTGTTGTTCCTCTTGTTGCCAAGGATTTGGAGCTGTTTGCTGATGCTGTGGCTGCTATGTCATCCAAAGGACTTAGAGTCATAGCTCTGGCCACGGGGTCTGACTTGCAGCAGCTGTCGTTCCTGGGTATAATGGGTCTGCTGGACCCGCCCAGACCCGGGGTACGTGAGGCTGTCCATACACTGTTAGAGAGTGGAGTACAAGTCAAGATGCTGACAGGAGATGCGCGGGAGACTGCACTTACTATTGCGGAAATCCTGGGAATTCATGTCAAAGGACGGTTAACGTTATCGGGAGAAGAGTTGGAAGGGATGGATAGTTTGCAATTAGGAGATGCCATACAACAGGCTTCAGTGTTTTATCGAGTCAGTCCCAGACATAAAGTAGCTATTGTTAAGGCTCTTCAGAAGCGTGATCACGTGGTAGCGATGACTGGTGACGGTGTAAATGACGCAGTTGCTCTGCGCCGGGCTGATATCGGCGTGGCCATGGGTCGAGCGGGGACTGATGTGAGTAAGGAGGCAGCGGACATGGTGTTGGTGAATGATGACTTCTCCACCATCTTGGCTGCCATCGAGGAAGGCAAAGGAATATTTTACAACATACGAAACTTTGTCCGTTTCCAGTTGAGCACGAGCATTGCAGCGATTTCTTTAATCACAATATCGACGTTTCTGAAACTTCCCAACCCTTTGAATGCCATGCAGATTTTATGGATCAATATCATAATGGATGGGCCTCCTGCCCAGAGTCTTGGCGTGGAACCGGTGGACCGTGACGTCATGAATAAGCCCCCGCGAAACGTCAAGAACCCAATGATCACCAGGGCCCTTATATTGAACGTGCTGCTGGCCGCTAGTGTTATAGTGACTGGTACACTGTGGGTCTTCTGGAGGGAGATGAGAGACAACATTATCACTCCACGTGACACAACCATGACGTTCACGTGCTTTGTGTTCTTTGACATGTTCAACGCGCTAAGCTGCCGTTCACAGGTCAAGTCGATCTTCCAAACAGGTTTCTTCACAAACCGTATGTTCCTTTACGCTGTTGGTGGTTCTCTCATGGGACAGATGTTAGTAATTTACTTCCCTCCTCTTCAAGCAGTGTTTCTCACCGAAGCTCTTCATTGTACGGACATATTGTTACTAACCTGCGTTGCATCCTCCGTTTTTATCGTGGACGAGATCAGGAAAATGGTTTTAAGGACGCTTTCTAGACGCAAACAACTTCCAAAGGACTTCCAGTATTACGTGTGA

Transcript

OS493_033550-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
P98194	Calcium-transporting ATPase type 2C member 1 OS=Homo sapiens OX=9606 GN=ATP2C1 PE=1 SV=3
P57709	Calcium-transporting ATPase type 2C member 1 OS=Bos taurus OX=9913 GN=ATP2C1 PE=2 SV=1
Q5R5K5	Calcium-transporting ATPase type 2C member 1 OS=Pongo abelii OX=9601 GN=ATP2C1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001630 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00690 all species →	Cation_ATPase_N	Cation transporter/ATPase, N-terminus	Domain	Interproscan
PF00884 all species →	Sulfatase	Sulfatase	Family	Interproscan
PF00702 all species →	Hydrolase	haloacid dehalogenase-like hydrolase	Domain	Interproscan
PF00689 all species →	Cation_ATPase_C	Cation transporting ATPase, C-terminus	Family	Interproscan
PF00122 all species →	E1-E2_ATPase	E1-E2 ATPase	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR004014 all species →	Domain	Cation-transporting P-type ATPase, N-terminal	Interproscan
IPR006413 all species →	Family	P-type ATPase, subfamily IIA, PMR1-type	Interproscan
IPR001757 all species →	Family	P-type ATPase	Interproscan
IPR018303 all species →	PTM	P-type ATPase, phosphorylation site	Interproscan
IPR036412 all species →	Homologous_superfamily	HAD-like superfamily	Interproscan
IPR044492 all species →	Domain	P-type ATPase, haloacid dehalogenase domain	Interproscan
IPR017850 all species →	Homologous_superfamily	Alkaline-phosphatase-like, core domain superfamily	Interproscan
IPR000917 all species →	Domain	Sulfatase, N-terminal	Interproscan
IPR023299 all species →	Homologous_superfamily	P-type ATPase, cytoplasmic domain N	Interproscan
IPR008250 all species →	Homologous_superfamily	P-type ATPase, A domain superfamily	Interproscan
IPR023298 all species →	Homologous_superfamily	P-type ATPase, transmembrane domain superfamily	Interproscan
IPR023214 all species →	Homologous_superfamily	HAD superfamily	Interproscan
IPR006068 all species →	Domain	Cation-transporting P-type ATPase, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR42861 all species →	CALCIUM-TRANSPORTING ATPASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005388 all species →	Molecular Function	P-type calcium transporter activity	Interproscan
GO:0006816 all species →	Biological Process	calcium ion transport	Interproscan
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0005215 all species →	Molecular Function	transporter activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0016887 all species →	Molecular Function	ATP hydrolysis activity	Interproscan
GO:0000166 all species →	Molecular Function	nucleotide binding	Interproscan
GO:0000139 all species →	Cellular Component	Golgi membrane	Interproscan
GO:0005783 all species →	Cellular Component	endoplasmic reticulum	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0006828 all species →	Biological Process	manganese ion transport	Interproscan
GO:0006874 all species →	Biological Process	intracellular calcium ion homeostasis	Interproscan
GO:0015662 all species →	Molecular Function	P-type ion transporter activity	Interproscan
GO:0016021 all species →	Cellular Component	membrane	Interproscan
GO:0034220 all species →	Biological Process	monoatomic ion transmembrane transport	Interproscan
GO:0070588 all species →	Biological Process	calcium ion transmembrane transport	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_033550-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_033550-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

30.5Max TPM

14.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.42	17.29
polyp at pH7 6	18	18	10.79	15.32
coral polyp · control treatment	16	16	19.46	30.47
coral polyp · oil and dispersant treatment	16	16	19.91	28.39
coral polyp · oil treatment	16	16	15.46	22.50
coral polyp · dispersant treatment	16	16	14.33	20.64
Polyp	10	10	5.91	10.55

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.29
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.79
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.13
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.82
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.17
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.28
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.44
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.39
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.17
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.81
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.60
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.18
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.47
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.46
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.82
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.77
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.12
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.86
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.32
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.63
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.08
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.78
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.70
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.34
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.12
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.55
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.42
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.75
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.74
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.50
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.36
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.75
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.05
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.85
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.59
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.70
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	30.47
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.14
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.87
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.90
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.45
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.73
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.19
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.87
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.82
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.40
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.03
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.03
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.84
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.05
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.99
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.55
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.39
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.21
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.15
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.10
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.59
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.99
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.39
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.98
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.86
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.69
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.99
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.77
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.86
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.90
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.60
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.06
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	22.50
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.80
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.24
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.65
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.52
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.24
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.13
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.89
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.19
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.15
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.12
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.88
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.26
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.40
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.22
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.24
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.64
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.88
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.86
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.39
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.44
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.40
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.43
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.36
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.96
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.76
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.65
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.25
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.12
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.92
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.71
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.53
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	10.55
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.68
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	7.73
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	7.59
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	7.43
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.93
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.02
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.56
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.38
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.27

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.