Gene detail

Detailed information of OS493_033671-T1 in Lophelia pertusa

Genomic Location: scaffold_271:329620...359840
NR annotation: KAJ7389088.1, Protein unc-45 A [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_033671-T1

ATGGAGAAGGATCCAGAGCAGAAGGGTGCCCTTGACCTCAAGTCCGAGGGAAATGCACATTTCAAAGAGGAAAAATATGAATTGGCAGTGACTTGCTATACTCAAGCATTGAAATTGTTCTCTCAAGATGAAAAGGAGAAGGAGAAGCTGAAAGAGAGAGGCGTGATTCTAAAGAATAGAGCAGCTTGCTATTTAAAGCTTGAAAAATTTGAAGAAGCTGTAAATGATGCAACAGAATCATTGAAGATTTTACCAAATGATTCAAAGGCCTTGTTCAGGAGATGTCAGGGACAGGAGAAACTGGGGAGACTGGAGGGTGCATTCCGAGATGCTCGTACACTGATCCATATTGAGCCTAAGAATACCATTGTACAGGAGACTCTTAAAAGGCTTGGTGCACAGCTACAAGCAAAGACTGATCGATGTCGTACCACTGATGGTCTTGTGGATGAGATGTTTACTTCGCTGTTCAATAATGAGGATACTGACGAGAAGAGAATGCAAGCAGTTAAGAATCTTGTGATTTTAGCCAATGATGAGCCAGGAGCACAAAGGATATTCAGAGGAGGTGAATTACCCAGAGTCGTATCGCTGTTGAACAGTGGATCTGATGAACAGACTGTGGCAATGTTGAAAGTCCTCAAAGGAATATGCACCAACTCTAAACTAAGGACGTTATCTGTGCTGAAAGAAGTTTCCTTGTCAAGGCTTTTAGCTCTGGTTGAATCACCAGGTGATGAAGTGGCAACAGCAGCTATCCTAGTTCCACAGCAAGCGTTGGATTCACTTATACCAAAACCACCTGACAAGAAAATCAACAAAGATCAAGAGCCGCCAAAGGAATTAGAAAATAAAGAGGAAATTCAAGGTCTTTTAACATTGCTAATGGATGCTGTTATGAGCGAAAAAGTTGGTGCTGAGGGTCGCGATGCAGTCATTGATGTTCTTATCAAAGTTATTCCCAAAAACAAGCTGGCTGTTGAACTTTTTGTCAAAGTTGGAGGTGTTCATAAGCTGATGGATGTTGCTGCCTGTACAGCTTCTCTGGAGTCTGAGGATAAGGAAGCCCTTGCAGTGTCTAATAACACACGAATGCACATCTCTGTGGCACTGGCAAAAATGGTTGACTCTTTTAGTTATCACCACAAGGAAAAGGAACCGCTGATGGAGGATGGAACAGCGGCTATCAGTCAATACCTCGCTCAAAGTAGTCCACAAGCACACATCAAGGGAGCCACAGCCTTGTGCTGTCTTTTTCAGGGAGTACCTGAAGCAGCCTCTACTGTTCTTGGACAAGAAGAATTCTTGGCAAAAATCCTAGCACTTGCTGAAAGAAAAGACCATGTGTCGCAGATTGTTGCATCTGAAACGTTAGCCTTGGGATCATCTGAAAAGAAGCTAAGCACAGTACTCAATTTGCGGGCCCTCCCTGTGTTGAAAGACTTGTACCATTTAAAGGATGACAGCATACGAGTCAGAGCCTTAGTGGGTCTTTGTAAACTGGGCACAACAGGAGGAGGAACTGTTAATGATCAGACATTTGCAGAAGGAGCCACATTAAAGTTGTACAAATCAGTGCGAAGCTTCCTGACGAAATCTAAGAAAGACATGGAGCTGCGTAAGTGGGCAGCAGAGGGACTGTCCTTCCTTACGATGGAAGCTGATGTTAAGGAAACCTTTCTTGAAGATCAGCAGGCCCTGAGATCACTCATGGAACTAGCGAAGGCTAAGGACAGTTCTTTGTTGTATGGAGTATGTCAGACGCTGGTTAACCTGACTAACACGTTTGACAAACCAGAAATACCTGATGAAATGAAACAGCTGGGAGAATTTGCCAAAGTCAAACTGCCAAAATTCGCTGAAAAGGATGGTGAAGAATATGTCAAAAAGAGGATCAGGAAACTTGTTGAAGAAGGTTTGATATCAGCGCTTGTTAACCTGTCAGATACAGAGAGTAACACCAGCAGAGAGATGATATCAAGAGTTTTCACGGGGATCACAAGTGAGCAAGAACACAGGGGAATTACTGTGCAACAAGGTGGAGTAAAGGCTCTGATGTCTCTTGCTGCCCAAAACACAGAAAAAGGAGCAGACTTTGCGGCACAATCCGTGGCTAAGATCGCTATCACAATGAACCCTGAAGTCGCATTCCCTGGACAAAGGTCATTCGGCTTGATTCGTCCCTTACTGATGCTATTGCATCCTTCTAAAACGGGTTTACAACAGTTTGAATCTCTAATGGCGCTGACAAACTTGGCCCAAATGAACGACGAAGTCAGGCGACATATCGTGAAGGAGAAAGGGTTCCCCTTGATAGAGAGTCTGATGTTTGATGAATATGATATGATCAAAAGAGCAGCCACCGAATGTATGTGTAACATGGTTCTGTGTGAGGAGGTATTCAAGATGTACGAGAAAGAAGACGCACCCACAGAGAGAGTGAAGTTAATGACTCTCTTGGCAGGAGAGGAGGATTTTGAGATGTCACGGGCGGCTTCTGGAGCACTAGCGGTCCTCTCTTCCAGCGAGAAAGTTTGCAAACAGATCATTAAGTTGTCATCATACATGGATGTTCAAAAGCAGCTGCTGGTATCTGATAAAAAGGAGCTGAGACACAGAGGAGCTCACATTGCTGCCAACATGATAGCCTCCAACAAGGAAATAGCGACTAAGATGATTGAAAGTGAAGTTCTTGAGATCCTGATGGTTTTCTCCAAAGACACCGATCCAGAGACGTCTATGATTCGAGAATGCGCCGAGAGGGCCCTGGAAAGTGCTGTGGAGCTCAACCTTATAAAACAAAACGAAGGAAAAGACTCCAGTTGA

Transcript

OS493_033671-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q32PZ3	Protein unc-45 homolog A OS=Rattus norvegicus OX=10116 GN=Unc45a PE=2 SV=1
Q6DGE9	Protein unc-45 homolog B OS=Danio rerio OX=7955 GN=unc45b PE=1 SV=2
Q99KD5	Protein unc-45 homolog A OS=Mus musculus OX=10090 GN=Unc45a PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003497 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF11701 all species →	UNC45-central	Myosin-binding striated muscle assembly central	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR024660 all species →	Domain	UNC-45/Cro1/She4, central domain	Interproscan
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR019734 all species →	Repeat	Tetratricopeptide repeat	Interproscan
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan
IPR000225 all species →	Repeat	Armadillo	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45994 all species →	FI21225P1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0051879 all species →	Molecular Function	Hsp90 protein binding	Interproscan
GO:0061077 all species →	Biological Process	chaperone-mediated protein folding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K21991	UNC45; protein unc-45	-	Chaperones and folding catalysts	ko03110	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_033671-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

15.9Max TPM

7.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.15	13.83
polyp at pH7 6	18	18	7.52	11.34
coral polyp · control treatment	16	16	8.31	15.57
coral polyp · oil and dispersant treatment	16	16	5.41	10.82
coral polyp · oil treatment	16	16	7.70	11.91
coral polyp · dispersant treatment	16	16	7.80	15.94
Polyp	10	9	4.16	8.05

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.83
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.24
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.30
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.88
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.42
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.40
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.28
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.81
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.78
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.45
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.41
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.32
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.19
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.81
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.56
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.55
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.52
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.90
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.34
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.95
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.28
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.16
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.62
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.24
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.60
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.48
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.32
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.12
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.92
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.73
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.20
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.03
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.80
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.13
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.87
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.52
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.57
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.48
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.62
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.12
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.45
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.22
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.16
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.20
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.09
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.79
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.10
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.18
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.02
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.62
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.52
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.79
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.82
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.29
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.86
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.31
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.11
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.28
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.72
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.07
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.04
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.02
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.40
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.51
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.07
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.33
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.23
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.47
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.91
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.67
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.92
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.16
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.97
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.42
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.12
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.03
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.11
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.63
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.03
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.76
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.82
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.25
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.37
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.11
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.94
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.02
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.80
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.33
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.68
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.60
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.92
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.47
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.59
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.46
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.31
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.96
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.98
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.65
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.06
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.08
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.05
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	7.22
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	5.73
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	5.05
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.70
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.05
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.18
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.38
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.20
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.