Gene detail

Detailed information of OS493_033894-T1 in Lophelia pertusa

Genomic Location: scaffold_276:337903...369310
NR annotation: KAJ7321786.1, hypothetical protein OS493_033894 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_033894-T1

ATGAGTGCGATATCTCATGCTTCGGATTCTGCTTGTTCCTGTTATGCCAACAGAGCTGCTGCTCTTTATCAAGCGGGGGCATGGTTGGACGTGTCAGCTCTGGTGGAATACTACACAACCAAGGCTGAAGATGCACAGGACAGGGTTATACTGGTGGTGGACAATGATGTGGTGGAAATTCCTCTTGTTGCATATACACCTTCCCCTAATTTGGAACTAAGTGGTCCTGCTGATTTTGGTGTGACAGTGGCTGATGGCAAAGTCTTATCACGAGAAGTTTTTGTTACAAATGAAGGATCGTTAACAGGAGAGTTCAAAATAAGGTACAGCGGCAATCAGCCAATCACAATCATGCCATCAGGTGGCATTATAAAGCCAGGAGCAAGGCAGACTGTTAAGATTGAGTTTATCAGCAAGACTCCAGGAAAGCTTGATGAAGAGGCACATGTTAAGCTGGAAGGTCAGCCTCCAACAACACTTCAAATTATTGGTCATGTAGTTGAGAGGTCTCTGGAGTTGTTGACACTAGACACAGAAGATGTTGTACAAACCATTAACTTTGGTTCAACGTACTATGGTACTGATCGGATGGAATCTTTCCTCATTTATAACAATGGACCAGATGTTGCTAACTTTGTTGTTATACTGGAAGAAGGTGGAGAGGGGCAAGAAGTGGGTGTTGACTTGACCAAGAGTGCAACAGCTGTGTTACTGTCCCAAACAAATTCCCAGGATCTTGGCACCGCTAATGACTTAACAACGTTGGTGACAGCTTTACCAAGTCAGGGAATCCTTTATCCTCAAGAAAAAAGAGAGATTTACTTTAGATTCAGTCCAAGGTACACCAAATCCAACATAGGTTGGAAGGCCAGTGACCAGCCACCACCAAGGAAAGATTACACTCTCTTCATGCATATAGAAACTGTGGGAAGTGTTGCTGGGATCTCTGAGAAATCCAACAGTGGAAATGGCAATGGAGGCACTAGAGTTGAAGTTGCTGTGCTGGGTACAGCTTTACCGGTGCTGCTATCCATTTCACCAAGCCCTGTGTTCAAGTTTGGAGATTGCGCTGTTGGTGAACAAATAGACGCCCTCTGTACTGTAAACAATGAATCGGCCAGTTTGCCACTGACGTTTTCCCTCCACTCTACAGCACATTTCCATTCATTGCCATCACAGGATCACATCAATCCTGGGCAGTCTGTAGATGTGTTATTGTCTTTCAGACCCAATCAGATGGGAACATTTAAGCCTGTAGTAACATTAGAAGTTCTAGGAGGCATTGTTGAGCAGTTTTCATTTGATGGGGATCCTACTGCTGTGAGGTTGATACCAATTTACACAACTCCAATCTACCTTCTTGGTGCTGGCACCAGGACAACCATTAAACTTAAAACACAGCCACTGTCTGGAGTGCCACAGGTTGCCCATCCAAATGATCGAGCCACCAGCATCCGACCAGCAAAGAGGAATGAAAATGTCAGGACATTATTCACAGGCATTGAAAGATACACCTTTGTAGATCCTGACTATGCTTTTACAGACGAGGAGGAGCAGCTCAGAGCTGAACATAAACAACAGTATCTAGACTATATCACAACTTTGAGAGAAAATAGACTGGCTGATGACAAGAGAAGTGACTTTAATCAGTTCAATAATGATACTGATTTGGGAATGAAGAGTGGCGTTGGATTAAAACCTCCGAGGATTTCAACAAAAGAACTTAGGTCCCCAGAAAAAGCTCTTTCTCCAGTTAGTGATGAGGTGAAGTTACTGAGTTCCATGACACTTGCAGGAGACAAGTCGCAGACCCTATCTAAACCATTGAGTGATGGCTTGAATGCTGTGCCGATGACTGAAAGGGAAAAGCGTGACTGTTCTTCAGTGCTCTCGCCTCAGCAACTGAAACTTGTGGATATAGGTCCCTCTCTGATGGACTTTGGCCAAGTTTGCCTGCGATCTGTTAGCAGTAAAGACCTTATGATTGTTAACAACTTGAACAGTTTCATTCACGTTGTTGTCGAGATTGATTGTCGTGAACTTCGTCAAACATCTCCCTTGTCACAAGTGATACCACCAAGCTCTGTGGCAAAGCTGGCTATGATGTTTGAATCAAATGTAAGAGGCAGGTTTGAAAGGAGCATTAACTACAGCATCAATGGCTATCATGTTCAGCACATTGTGGTTTTGGCAGAAGTTGTGTCTGTTGCTTTAGAGTTATCAAATGATGAAGTTGTCCTTAGCCCTTCTCCTGGCCTCTTAGCTGAATCAGGTCTCCGAGGCTCCATCACCCTGTTAAACAAAAGAAACTACCCTGCAGAATTTTCCTGGTCTCCTGTCATGGATGAAAAGGGCACGGCATTCTCCATTAGACCATCAATAGGTACTGTTGAAGCGTTTACCAGCTTGGAATGTGAGGTTGTTTATCACCCAACATTTTCAGCTCCTGAAGAAACTGATTTCCTTGTTCATGTAACTGGAGGGAGTGATCTGAAGCTAAAATGCATAGCCAAGCTTGGCACTGCCCATTGTGCATTTGTGGAGAGAAGGCTTCTGTTTGGTTCAGTACCTCTTCATTTAACTACAGTGAAGACAGTGTCCCTTCGAAACACCAGCCAAAATCATGCTTACTTTGAGGTGATTGACACTCGCCCTATCCCTGGAATGATCATTTCTCCAAAGGAGGGATTAGTTCCAGTTGGAGGAACAGCAGAACTTAAGGTGGAGTTTACTCCTAATAGTATCCACAAGTTTGATACTCACATCCAGGTGAATGTGCGAGGGTGGAAGATCATCTCGCTCAGAGTGGGTGGCACTATAGAACCTCCCTGTGTAGACATTGATGCGAGTTCATTTCAGTTTGGCGGAGTCCACTGTGGTGCTTTGGCAACTGTTAGATTTCAACTGAGCAACGCGACCCGCACTGAAGCGGACATGGTATTTGACCTGAGCAGATTCCTGGACTTTTCACTTAAGTTCCTGGACACTGATCTTGAAGATGACCCTGTGGATGACGGGAATGGTGTTTACCATGTCTGTTTGAAAAGTCAACAAGTCATGGAGTGTGCTCTGGAATTCCAGCCTTCTGAGGTTGCATCCTATGATTTTGTTATTCCTGTCAGCATCAATCACACAGTGGCTCCTACTCCAGCGCCATCAACCTTCCCTCCAACTCCTGCCCCCTCACACATGAACTGGACCATCTCTGATCTAATTACACCTGTACCCTCTCTGATGGGCGTGGCCACTCCCAGCCGTCGTGTGGTGGCAACAGCTCTACGCCCCCCTCTGCAGCTGTCGCACTCTGTTCTTGAGTTCCGCCTTCCATCTGGTTATTTTGAGCTTGGTATTGAGTCAGGGGCGGGGCGAGCGCAGCGATCAAGCCTTGACATGGACTCTACACACCAAGGCTGCAGGGCCTTGATGGAGGATGGCACCTTTAAATTCCTTCACAGGACAGGCTCACCTTTCACACCATCATCAGCAGGAAAGAAAAGTGTCATTCCTGACATCACCCTGGAAACTGGAGAGACTTTTCAACTGGGAGTGCTTTTTACCCCACAATGCCCAGGCGTGTTTGTGGTGCATGTTCCTGTGATCTTGAATGGTAACAGAGACATTCCTTACCGCACCCTGACCCTCAAGGGGGAACTGCTAGCACCCAACCTGAAGTTTGATCCTGATTGTCTACGGCTAACACCTGTGCCTCTTGGTACGCAAGTGTCGGTTAATTTTAACATCACTGCCAGGGGATACAGAAGAGCATCAGTTATAGATTGTGAAATTCCAGAGGTGGAGCTAGAAGATGGCAGCGTACAGTCGGTGATGGAAGTGTCTTTTCCTGATGGACAAGCAATTCAGCCATGCTGTACTCATGATGATAAAGGAGAGCCTTGTGTGATTCCTTGCACCGTTACATTCCAGTCCCCCAGTCCTGTCACGTTTACCACAGCTATCATCTTCACAGATGGAAAGGAAAAATATGAGCTTCCAGTGACGGCCACTGCTGACAACTGTCTGCTCTCGTGTTATCCCTTCCTGGCCTCACACCAAACAGATTTCCACATCATCTGTGAACAACAAGGAATATCAATCCGAGATAAACAAACAGATGCCCAAGACTACCACCCTGGAGAGGCTGTGTTCATGCCATGCATCACCCCCAACCGTCCCCCCACAATCGCTTCAACTAGTGCCACAAGCACGAGCTTTGGTATCAGCACATCGACATATCCAGAGTCTAGTAACGAGGCTACATCGTCCACTTACCCCTCCACGCCCCATCACGGGGACTCTCAACATGTGGGTGCTGCTCGAGGGGTCTCTGATGTATCTGATACAAATGGAACCTTTGTTTTGGGACCTGGAGTTGAGAGTGATGAGAGAAAGTTTATAAGGAAAGTCATTAGTGCCGTGCAGAGGTACTTCTCAGCACAGGGCTGGTCTGGTGGGCCCTACCCAATAACCGTACCTCAGACCCTGCGATCAGCTCTCCAAGACACAAGTGATCCCCAGACGGGTGGTACAGGGGCTGCAAGGACATCGAACTGGGATAATAATTCCAAAAAGAACTCAGATCAGTGTTTGATCTTGTCGGTCATCTGTGTGGTCGTCCTGTCCCAGGAATTCCACTAG

Transcript

OS493_033894-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6ZTR5	Cilia- and flagella-associated protein 47 OS=Homo sapiens OX=9606 GN=CFAP47 PE=1 SV=5
A0A0G2JEB6	Cilia and flagella-associated protein 47 OS=Mus musculus OX=10090 GN=Cfap47 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002524 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_033894-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR008962 all species →	Homologous_superfamily	PapD-like superfamily	Interproscan
IPR000535 all species →	Domain	Major sperm protein (MSP) domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45912 all species →	CILIA- AND FLAGELLA-ASSOCIATED PROTEIN 47	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005929 all species →	Cellular Component	cilium	Interproscan
GO:0060271 all species →	Biological Process	cilium assembly	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_033894-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_033894-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

108TPM > 0

7Conditions

29.8Max TPM

3.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	2.84	5.11
polyp at pH7 6	18	17	2.41	3.92
coral polyp · control treatment	16	16	5.74	29.79
coral polyp · oil and dispersant treatment	16	16	4.50	24.76
coral polyp · oil treatment	16	16	3.56	5.97
coral polyp · dispersant treatment	16	16	3.77	7.92
Polyp	10	9	0.76	2.13

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.11
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.71
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.56
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.31
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.45
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.17
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.15
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.08
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.54
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.46
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.40
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.34
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.25
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.14
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.10
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.99
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.89
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.53
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.92
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.76
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.56
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.40
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.35
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.17
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.10
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.00
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.96
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.78
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.25
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.87
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.62
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.20
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.19
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.10
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.09
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.79
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.12
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.30
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.93
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.18
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.29
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.22
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.66
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.47
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.29
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.19
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.00
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.78
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.64
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.21
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.74
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.76
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.10
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.85
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.79
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.71
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.62
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.22
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.17
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.12
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.79
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.25
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.23
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.19
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.98
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.96
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.33
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.97
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.85
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.64
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.35
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.20
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.09
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.01
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.67
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.65
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.55
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.29
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.10
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.04
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.69
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.67
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.16
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.92
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.04
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.37
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.92
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.59
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.41
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.40
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.20
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.10
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.94
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.94
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.64
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.45
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.84
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.52
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.05
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.13
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.24
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.12
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.80
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.67
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.65
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.45
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.27
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.25
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.