Gene detail

Detailed information of OS493_033928-T1 in Lophelia pertusa

Genomic Location: scaffold_277:366830...395619
NR annotation: KAJ7389068.1, hypothetical protein OS493_033928 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_033928-T1

ATGGGATCACAGACATTAGAGATCTTGCGGCAGGGAGTTTGGGCTTCACTGACCGGCGGGTGGTTCTTCGACCCTCATCAAGAAATATTCACCAACACTTTTCATTTCTATTTGTGGATTGTTCTGCTTTGCCTGCCGTTCTCGCTATACCTGGGAACAGCTCCGTCCATCTTGGTTTGGATAGTGTATTCCATTGTGATTGCAATCATTTTCTTGGTGATAAAATGTCTGAATTACAGACTACACTTGATGTTCGATGGCGAAGAAATCCGAACAGAAAGTGAACAGCAGGAAGTGAGAAGTGGAGAATCAGGAGCTGAGCGGGACGAGATATCACGAGTGGAGGTTAGCAGTGGCCCTGTGGAGCATGGAGGGGAAGTAATTGAACTGGAGGTGATAAACCGTTGTTCGCAAGATGCTGCTGCCAATGAAGGCGGCGAAGAAAATGTAGTGCAACCAAGTACTACTTCTGCAGCTCTATCCACACCGCTTCCTCCTCCTGTTTCCTCCTCTCTTCTTCTAAACTCGTCATCAATTACAACTGCTTCAAGGCCTCATCAGAATGAGCGTAATGAGCAAGATCTGAAGAGACTAGTACCACAGGACTTGGGACACTGGGATATTCATTCAGGCCGTAGATCTCCACCGCAAGTTTCCCAGGCTTGTGAGGGAAGTGAGGAACAAAGCTTGCATAAAATAGAGTGTTATGATCTAGATGATGGGGGTGAAGATGAAGATATGGTTGTTGTGGCTTGTCGGAATGATAGAATCAAAGAGAAAGAGATTAGTTTTGCTGATGAGCTGGAGAAAAGTGACAGATTAGAACACAGTATTAGGCAGAGTCCAAGTGGACAGATTGAGTCTTGTGAAACTATTCATGAACATGTCAATGACACCTTGAGTGATCTATCTACACTTCCATTACCCATCTTAGACAGCCATATGGAATCACGTTCTGTTCCTGGCCTTGTTGTGTCAGACATATGGAAGATTGAAGAAGGGACTCATGGCCTTCTCTTGCAAACCAAAAGTGAAGGCTCAAATGTCAATGGAACAGGCAGTCCGAGGAACATATATCAGGCTCTTGTCTCAGCCCTAGAAGGTCATGGCTCTCCCAGACAACAAACCAGCTCAGGGGACATAAATGGTGGGACATCATTTGGGTCTAGACTAGGTACTCAGTCTGGAATTGAAAGCAGATCTGGGTCAGAGTATGAGGGTGCAAGTCTTTCTCGGCATGAATCGCAGAGCGACAAATCAGTTGGCCCAAGAATGCGATCGATATCTGACATCGTGCGAGAAACAGAAGACTGTGGTGAAGGAGAAGATGACAGGCAAGTTGGAGCGTCTGGCATCGACACTCCTTCAATCTTAGACACTTTATCTTTACAAGACTCTGGTAGATTTCATAATCCTTCTACAAGCTCACAACCAGAGTCAATGGATAGTGTTAGTGTCATCACAATGAACAAAGACACAGCTTCCACTGTGGCACAAACAGGAAGTATAGGAGAACCAGATGGGTCTGGACGAGAAAGCTCCGACCTCATACTTGCACGACGATCGTCATCCTTAGCTCGCAGAAGGAGAACAAGCTTGCAGAGAAGGAGGAGACCTGACACAGGGGCTATTAGACGCCGCAGACGTAATGACTCAGGAGCACTGGCTGACATGCTGCTTCAGGCTGTCGATGGCGGGGGACCAGGCTCTTCAACTCACGTAGCATCATCACACGATGATACTACCCCTGGAGCTCTGCATTGTTTTCAGGATGAGTTTGGTGTGTGGCAGACCTATATTTTCAATGCTGATTCACCATTCAGTACTGTCGTACAGCCATCCACTCATTCTCCCATGAGGATCAGAGATTTAGTCAGAGACAACTGGGAAACAAGTAGCTCTGCATCAACAGTAGTTGTGGACCACACAACTTTGCCTGGAAACCTCCAAACACACTCGTCAACTGTGCGTCGCGGATCTTCCCACACAAGGTGGCAGGACACCATCTCATCAGCCAGCCTTCCGTTCACCAGGCCGACATCTGTTACATCAACAGTAAAGCCCAGACCTCACTACTTTAAATTTCAGCTTTTACCTGGAAAATTCATGAAAATCAAATTTGATCGACTTGTTCTTTTAGCTCTCATGGATAGAAACAAGTACAAAATTGAAGCAGTGGTGTCAGTTTTGCTAGCTGTTCTGGTGGCAGTTCTGGGTTATTGGCTTCTGCTGGCAGATTTTTTTAAAGACTTTTGGATATTTGTGTTCTGTTTTGTGCTGGCTGGATGCCAGTTTTCTCTTATTAAGAGTGTTCAGCCTGATGCAGCCTCTCCAACACATGGACACAATCACATGATCGTGTTTAGCCGACCCACATACTTCTGTGCCTTGGCCATATGTATCCTTGTGCTGGATAAACTGGTTCAGTCAGATTTGGTGACGTTTACTATATACGGCGTCCCTTTTGCTACCAACTTCACACTTTCATATACAAGAGACTTTCTAATTGGTTTTATGCTTGGTTTCCCATTACTCTTCCTTGTTGGTCTGTTACCTCAAGTCAACACCTTTCTCATGTATATACTTGAACAACTGGACATGCATGCATTTGGAGGAAATGCCATTACAAGTTTAAAGGGAGCATTATGGAGCTTGCTTCGCAATCTGTTAGCAGTCAGTTTTCTTTTTGGATTCTGTTTTGGAGCGATGCAGCATGGTGCAGAAGGAGGACAGCATGTACTGTTTTCTGTGTTTAGCGGCCTTCTTGTTGCCATTTCTTATCATCTGAGTCGCAGTGCCAGTGATCCTACAGTTCTGGGGTCAGTTTTCAAAAAAGCCTTTGGCCAAGAAGCTGGTAGTGATAATGATGAAGAATTTGTTGACCCTTTACCTGAGAAACTTAGAGCCACTGTGGCCAAGCGTTTGCAGAATGACATAGTGTGCTGTATTTTTATTTTGGTGTTTGTTTTTGCTATTCACTTGAGTACAGTATTTACAGCTCTTCAGCCATATGTCAGTTATGTTCTGTACGCTGTTGCTGGCTTGCTGGGTATCATTAATCATTATCTATGGCCACAGCTTCACAAGCCATTGCCCTGGCTCTGTTTCGCCAGACCCTTTCTACGGAGTCGCGAGTTCAACCAATATGAAGTAAAAGCTGCAGCCAAGATCATGGCGTATGAATGGATTCATGTCTGGTTGAATTTCATAGAAAGGAACATCATTTATCCAGCTGTGTTCTTAAGTGCGTTGACATCAAATGCCAGCAAACTTGTCCTGAACTTCGGCCCGTATGGTGGTCCAGCGGTTATCTGTATCATGGGCTTGAAGCTGTTACGCTCCTCGTTCTCAGACTCCTCTCGGCAACACCTGGTGCTGTTATGGACAGTTCTATTTTTTCACTTTGATTATGCCACAGTTCGGAGACGTTTGTTGTGGACTATTTCTTATGTCCATATTAATGAACAAGGTCCGTTCGTGGTGACGTATATAGCACCTTGGCAGATCACGTGGGGCTCTGCATTCCATGCCTTCGCTCAGCCCTTCAGTGTTCCTCACTCGGCCATGCTGTTTTTCCAAGCACTGGTGTCGTCTGTCCTATCTGCTCCATTAAACCCTTTCCTGGGTAGTGCCATATTTATTACGTCATACGTGCGACCTGTCAAATTCTGGGAAAAGGATTACAACACAAGTCGTGTGGATCATTCCAACACTCGTCTCTCCTCACAGCTCGATAGAAATCCTGCACAGCCTGTGTGGGGACCTTATGATGGGCCGTTGGGCCCCTTTTCCACAGGGGACTGTTTCGTGTTGGCGTCAGACTATTTGAATGCTTTGGTTCACATCATAGAAGTTGGCAACGGTCTGGTAACCTTTCAGGTCCGAGGGTTGGAGTTCAGAGGCACGTACTGTCAGCAGCGAGAAGTTGAAGCCATCACCGAGGGAGTTGAAGATGATGATGGTTGTTGTTGCTGTGAGCCGGGCCATCTTCCCAACATGCTTTCGTTGAATGCAGCGTTCTTTCAGCGGTGGTTAGCATGGGAAGTAAGCGCGACCAAGTACATCATTGAAGGTTACAGCATCAGTGACAACTCCGCGGCATCCATGTTACAAGTGTTTGACCTGCGCAAGATTCTAGTCACTTACTATGTGAAGTCTGTAATATTCTACGCAGTACAGTCATCTAAGCTGGATCAGTGGTTACGCAGTGATATTATACGAGAGCAGCTGGTCGCTGTACACGATGTACAGTACGTGGATATAGATCGCACCTTTTATCACAATATTGACGAGGATTACGATCTGCGACAGGGCGGCATCTCCAAATCCAGCTTTCTGAGCTGTTACCTGGCTTGGATCCAATACTGCGCTTTACGGAAGGACCCGGTCAGTAAATGCTCACAGCTCAACTGGAACTAG

Transcript

OS493_033928-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q98UF7	Pecanex-like protein 1 OS=Takifugu rubripes OX=31033 GN=pcnx1 PE=3 SV=1
Q9QYC1	Pecanex-like protein 1 OS=Mus musculus OX=10090 GN=Pcnx1 PE=1 SV=3
Q96RV3	Pecanex-like protein 1 OS=Homo sapiens OX=9606 GN=PCNX1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002671 (this species only)

Pfam domain

No Pfam domain signature was detected for OS493_033928-T1. This gene does have a gene model — the search simply returned no hit.

InterPro

InterPro term	Type	Description	Source
IPR039797 all species →	Family	Protein Pecanex	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12372 all species →	PECANEX	Interproscan

Gene Ontology

No Gene Ontology signature was detected for OS493_033928-T1. This gene does have a gene model — the search simply returned no hit.

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_033928-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_033928-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

19.9Max TPM

9.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.68	12.91
polyp at pH7 6	18	18	7.98	11.92
coral polyp · control treatment	16	16	12.09	19.89
coral polyp · oil and dispersant treatment	16	16	12.19	15.97
coral polyp · oil treatment	16	16	9.38	14.27
coral polyp · dispersant treatment	16	16	11.29	17.52
Polyp	10	10	3.68	6.54

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.91
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.87
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.74
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.63
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.59
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.14
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.91
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.70
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.44
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.93
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.82
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.71
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.51
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.46
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.12
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.04
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.87
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.81
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.92
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.42
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.31
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.03
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.72
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.02
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.98
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.96
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.63
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.21
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.47
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.13
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.10
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.19
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.01
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.84
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.68
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.94
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.89
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.31
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.36
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.67
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.20
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.68
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.56
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.86
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.85
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.80
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.79
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.23
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.72
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.19
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.97
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.38
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.97
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.71
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.23
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.71
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.55
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.95
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.29
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.68
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.42
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.08
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.83
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.28
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.06
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.01
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.45
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.87
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.27
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.36
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.35
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.98
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.33
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.19
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.44
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.30
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.74
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.59
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.35
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.38
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.25
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.95
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.09
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.56
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.52
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.15
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.47
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.30
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.21
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.52
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.86
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.34
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.98
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.43
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.26
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.07
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.76
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.65
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.62
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.43
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	6.54
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.37
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	5.24
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	4.93
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.04
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.09
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.23
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.04
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.68
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.67

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.