Gene detail

Detailed information of OS493_034341-T1 in Lophelia pertusa

Genomic Location: scaffold_288:35831...63333
NR annotation: KAJ7321722.1, Cilia- and flagella-associated protein 70 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_034341-T1

ATGGCGAACGAAGAAGAAGCAGCGAGCATCAGAGCACCGGAATCGGTTACTATAACAGTGGTGCGATGTAAAAATCTGAAAGGGTCAAAAGGTGATTCTCTAAACTCGTTAGTAAGACTTGAGTTTGGAGCTAATCTGCTTGGAGAATCACCAAAAGTTGAAGCCAACACAGAAACTCACAGTACAGAGTACAATTTTCATGCGTCATTTGATTGTAATTTTGAAGATGCCTCTTCCTTGGATTGCATATCATATAAGCCTGTTATAGTCACTGTTGTAGAGGTCCTACCCAAGGACAAGAAAGGAAAAGAAGAGAAAATAAATGTCCTGGGTCAATCCTGCATTGATTTGCTGCCTCTGCTTCATGGAGAAACCAAGTTCAGTGTTATGCAGTTTGTCCATCCAGTCACTTTACCAGCTGAAACAGCCACCACAGAACATGTTCTGCCTGAAATTGAAGTCCAAGTCTCCGTAGCGCAGCCTCTTCTTACAGAAACACAACTGAGTAACAGCAATCTGTTAAGCATCCATGTGGATAGCGCCTTCTCTGTACCAGACTCATGGCAGATTCCAATGGCTCAACAGTTTAATTACACGGCTAGCCTCCCTGTTCCAGTCTCCAATGAGAAAGAGAATACAATAGTCTTATCCAATGGGATGCTCCGTGCTCCAGGCGAAAAGGAAACTACAAATCAACGCAAATGGTCAGCCGCTCCGAGTGCATCGGGTTCCTGTCTGTACATCGCTGACAGTGCCATCGAAGACATGCCGTTTGATGATGAAGACGGTGACCTCAGAGACAAAGAGGATATCTCATTCCGTCAGGAAGCCATTAACGAGAAAAACCACGTGACCTGGAATGCAGAAAGACGGTGCTTTATAAGTGCAGACGCTGCTGAAAGTTTGCAGAATAAGATCGCTCAGAATCGTTTCTGGCCTGTGGAAATAATGAGGACTCCAGTGCAACAGGCCACCAAGGCGAAAGGAAAACAGGGCTCGCTAGAGGAGGATATCCCCATATCTTTCCACGGAGTAGCATACGTCAATATGGCGCCCTTACTATATCCTGGAGTAAAAAGAATAAGAGGTGCTTATCTTGTGAAGCCTTTTATCGAGACTGAAGTGTACGAGAAAACCAAACGCAAAGGCACATTGGCGGAGGAGGCTGCTAGAGTGGCCAGTGGAATGAGCCGCACGCTCGCCTCAGCCATGGCCCAGAAGGCTCCTCCACCTTCCAAACAAGGCAAGGCAGATGCCAAAACAAAGCCATCAGGTGCAGTGCTTAAGCCAGACATGTTATCAGAAGGAGAAAGCAACGAAGCCAAGAATCTTGAAGGACAGCAATACCTCGAATCACGAACGTTTATTACGTTAGAATTTGTCCTCGACAAGCCGCTGGTACCCAAGAGGCCACCATCGTCGCTTGCAAGAAAAGTTGCAGAGTATATTCCACCACGTCCTGTATTTGCCCGCAAAACAGGAGGGTCCAAAAAGGCTGTGGAAGATTTCCACACTCAGTTGACCACAGTGGCAAATTCTCTGCTGGAGGAATTCAGGCAAATGTACGGTGATGATTTAATGAAGGGGAACCTTCCACAGTCAAACGATGCCATGGATCAAAGGAGGCAAAAGTTTCTCTACGAGTTGAATACGTCTGGAAAATACTTCGCATTCAAAGAACAAATGAAGAACAGTGTCATAAAGATTGTACGAGAGAAGTACTTAAACACCACAGCTTTTACAGACAAGGAAAAACTTCAGGCATTCATCAGCGAGTTGTACGTGTTTTTAATCGACCAGATGCACGTTGCCTTAAACAAGTTTCTCACAGCAGAAGAGACTCCAGAGGAACCCCCGCCTGTCACAGACTCTGCAACTCTCAAACACTTCGCCAGGGAAGCTGAGGTCAATCAGAATTTTGAACTTGCGGCTAAGTATTACCAAGAGCGGTTGTCTCGTAGCAAGAACGATCCCGATCACTGGTTTGATTACGGGGCATTTTGTTTACTTATTGGTGACTATGGAAAGGCCGAGGAGTGTTTCAAGGAGACTATAGCAATCGCTCAAAAACATGTACCAGGTCTCCTGATGTACGGCTGCATGGCTCTGATGACTGAGAAGTACGAAGAAGCTGAGACGTTTTTTGAGGCGGCAACTTGCGCTGAGAGCAGGAGCGTTATTGCATGGACCATGCTAGGATTGTACTATGACGGTATACAAAACGACATTGGAGCTGAGCGTGCTTTCCTTGAAGCCAACCGCTTAAACGTAGCAACGCTGTCCTCTATTGAGCTGGCAGGCACAGCTGACATACCAGCCGAGATTGACAGTTTTTCGGAGCTTGGTACCGAGGAACCTGTTGGCGAGGGTGCTCATGCAACCGGTGCCTCTGAGGACCCGAAATTACCGGAAGTTCATGTTGACGATATGGCGCGCGAGGAGCCTGTGCCGGGAACTGGTGAAACTTCCGCTGACCTCTCAGCTCCGCCAACCGCAGGCCTGCCCCCGGCAATCGTGTTTAGCTCAGCAACGCCTGTGGGAAAACCCGGAACGAAACCTCAGACCCAGTCCTCCACAAACATGGCTTCCAAACAGAGCTCACGTGTTCCTAGCCCTGGTAGTTCCCACCGACAATCACCGGCCCCTCCTGAATCCGAACACACGGTACCCTCGGAGGAGAAGCCAGCGGAGGTCAAGCCAAATGCTAGTATCTTCTTGCAGGCGGCGAATTTCTTACTGGAAGTGAATGCCCTGCAGTTAACGGATGGGGCTTTGGCGCACGAGCTAGTGGCGGCTAATGGAGAGCCTGGGGCCGATTATTACGTCCTCCTTGGAAGGTTGAAGATTCAACAGAAGTCTTTCATTGAAGCAGAGGAGAATCTTAAACAAGCCGTCGTGTTGAAGCACCAGAACCCAGATGCGTGGGGCTTAATGGGCCATCTCTATTATCTGACAAGCCGAACCGAGGAAGCCCGGGACTGCTACGAAAGAACGCTGGTCTATACGACAGAAGCCTCAGATATGCACGCTATCTATCTGAGACTCGCGTCGATCTACCTGGAGAAAGGAGAGTTCGATAAAGCGAAGACGACCTTCCTGAAAGCCTGCATTCGCTCGCCATCCTGTGTCTCTTGGCTCGGAGCTGGAATTGCTTGTTATAGGCTGGGTGATTTAGCCGAAGCCGAGGACGCTTTATCTGAGGCGAATATTTTAAACAACAAAGATGCAGAAGTGTGGACTTATCTCTCCCTCGTTTGTTTACAGACTGGTCGACAGTTGGAAGCTGAACAGTCATACAAGTACGCTCTCAAGTTAAATCTACAAGACGAAAATCTGCTAGCAGAGTTACATCAAACGCAGCAAAGGGTCGGCTTTGGAAATCCTATGGTGGCATAA

Transcript

OS493_034341-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5T0N1	Cilia- and flagella-associated protein 70 OS=Homo sapiens OX=9606 GN=CFAP70 PE=1 SV=3
D3YVL2	Cilia- and flagella-associated protein 70 OS=Mus musculus OX=10090 GN=Cfap70 PE=1 SV=2
Q95LN2	Cilia- and flagella-associated protein 70 OS=Macaca fascicularis OX=9541 GN=CFAP70 PE=2 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003955 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13181 all species →	TPR_8	Tetratricopeptide repeat	Repeat	Interproscan
PF13432 all species →	TPR_16	Tetratricopeptide repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR019734 all species →	Repeat	Tetratricopeptide repeat	Interproscan
IPR052628 all species →	Family	Cilia- and flagella-associated protein 70	Interproscan
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR44314 all species →	CILIA- AND FLAGELLA-ASSOCIATED PROTEIN 70	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0003341 all species →	Biological Process	cilium movement	Interproscan
GO:0031514 all species →	Cellular Component	motile cilium	Interproscan
GO:0060271 all species →	Biological Process	cilium assembly	Interproscan
GO:0070062 all species →	Cellular Component	extracellular exosome	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K24932	CFAP70, TTC18; cilia- and flagella-associated protein 70	-	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_034341-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

42.3Max TPM

8.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.53	10.06
polyp at pH7 6	18	18	5.60	8.44
coral polyp · control treatment	16	16	12.92	37.58
coral polyp · oil and dispersant treatment	16	16	10.15	42.29
coral polyp · oil treatment	16	16	9.53	16.42
coral polyp · dispersant treatment	16	16	8.96	17.69
Polyp	10	9	5.03	8.30

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.06
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.87
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.87
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.65
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.21
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.15
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.52
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.50
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.48
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.42
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.13
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.83
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.52
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.36
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.27
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.09
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.94
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.75
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.44
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.10
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.91
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.81
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.28
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.21
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.98
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.72
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.66
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.59
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.46
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.23
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.18
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.02
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.47
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.95
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.66
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.19
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.58
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.01
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.19
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.88
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.40
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.09
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.77
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.65
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.14
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.11
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.41
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.40
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.46
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.10
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.00
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.48
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	42.29
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.85
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.54
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.76
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.31
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.14
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.48
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.24
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.39
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.22
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.32
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.04
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.73
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.65
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.03
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.43
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.42
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.63
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.56
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.14
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.81
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.61
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.53
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.18
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.94
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.11
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.47
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.29
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.93
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.80
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.68
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.39
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.69
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.43
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.30
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.81
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.73
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.37
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.98
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.20
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.19
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.46
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.35
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.11
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.03
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.89
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.35
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.40
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	8.30
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	7.48
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	6.65
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.53
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.40
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	4.96
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	4.52
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.73
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.70
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.