Gene detail

Detailed information of OS493_034581-T1 in Lophelia pertusa

Genomic Location: scaffold_295:29611...41235
NR annotation: KAJ7388949.1, hypothetical protein OS493_034581 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_034581-T1

ATGGGAACATCAGAAAAGGAAGAGTGGAAGGAAGGCCCTGTAAACATCAGCCCACAGTGCCAAATAGCACCTATGCTCTTGCGCATGACATGGGACGGCTTTCCGCTGTACTATACCCGTAAACATGGCTGGGGGTACCTTGTGCCTGGCAGGACGGACAATCTGACAGCCAAACAAATCCGTTTACCACACAACGAGGATGATCAAGTGGAAATAGAAAAACCAGAATTACCATTCCCAACAAGAGCATTTGATAATCTTTGGAAAAAACACTCGATGAACACAACTCGAGAAGAAGCAGACGAAGCTGATTCCAAGTTTGCCAATGGAGAGATGGATGTATACAATCTTAGTGAGGATCAGTTGTGGACGAGCTCAGAGCTGGAAGAAATGAGGAAACCAAACACTTCTCAAACCAAGAAATCTTCCAGTGCCGTGGTTAGGAATGAGACCATAAAAGAAGAACCAGAGGGAGCCCCTAAAAAGAAAGCATCTCGAGTAAAGACCAAAGGAGCAAAGTCAGGAGCGGAAAGCAGTCCTGATTTTTATCATGGTGTTGGACCTTATAATGATATTGATCATCCAGGAGTATGGTTCTTCCGGATACCGCACAAGAATGGCGAGAATCACCGGTGTGGAAACCCGCTGGCCAAAGACTATATGACCAAGATGGAGGATGGAACACTGGTGGCCTCCGGAGATCACAGCGCTCACAAGACGCTGATTATTAACAAAATGATTTCCTCCTGGAGAAACGCACAGAAACGCATCAGATCTCAGCTAGCTGTATGGTTCAACAGGACCGACCTAGCCTCAGAAATTACAGGATCCGAAAAGTTCAGTGCTGATAATATGTATGGCGCCATCTTGCCTCGTATAATCACAGCAGGAACTGTAACAAGGAGATCAGTAGAGCCCACCTGGATGACGGCCAGTAATCCCAGAGAGGACCGTGTTGGCTCTGAACTGAAGGCCATGGTGCGGGCTCCTCCAGGCTACTGTTTAGTAGGGGCTGATGTAGACAGTCAGGAGCTCTGGATTGCTGCTATTTTAGGAGATGCACATTTTGCTGGGATACATGGAAGTACAGCGTTTGGCTGGATGACCCTACAAGGCAAGAAGTCAGAAGGTACAGACCTTCACAGCAAGACCGCACAGACTATTGGGATAAGTCGAGACCACGCAAAGATTTTTAACTATGGCCGTATTTATGGAGCAGGACAGAAGTATGCAGAGAAGCTGCTGCTACAGTTCAACCACCGCCTGACGGAGAGCGAAGCGAAGCTGAAAGCAGAGACGCTATTCGCTAACACCAAGGGAATGACCAAGTTCCATCTTACAGATTTTGGAAAAGCAATGGCAGAAAGGGTTGGCATCGCGGAAGACATCGATGAAAATGGATGCGTGGTTTCAAAAGTTTACTACCAGCTGTTGAGGAAATCTTCGCGAAGAGCACGTTCTTCTGGAAACAGCATTGACGATGGCCGGCGATGGTGCGGAGGAAGTGAGTCTGAGATGTTTAACAAGTTGGAGAGCATTGCACAGTCAGAGGAGCCGAGGACGCCTGTGCTGGGTTGCAGGATCAGCAGATCACTGGAGCCATCAGCTGTGGGATCTGAGTTCATGACCAGCCGAGTCAACTGGGTTGTTCAGAGCTCTGCTGTAGATTATCTACACCTCATGCTAGTTTGCATGAAGTGGCTCTTCGCCAAGTATAATATTGATGGACGTTTCTGTGTCAGCATACATGACGAGGTTCGCTATCTGGTCTCAAGCAAGGACAAGTACCGCGCAGCTCTGGCACTACAGATTACCAATCTCCTCACCAGGGCAATGTTCGCGCATAAACTTGGAATGAGCGACTTACCACAGTCGGTGGCGTTCTTTAGTGCTGTTGATATAGACACTGTGCTACGTAAAGAAGTGTCACTGGACTGTAAAACTCCATCCAACCCGTTAGGACTCCACAAGGGACAAGGAATAGCACCAGGGGAAGCGTTGGACATTTACGACATCCTAAAACTTACTCATAACGGCGTCCTACAAGAAGACCCAGAAACAGAGAAGGACCACAACCCTCAGAAAGACGGGACAATTCTACACTCTTCAAACTAA

Transcript

OS493_034581-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q92076	DNA polymerase subunit gamma-1 (Fragment) OS=Gallus gallus OX=9031 GN=POLG PE=2 SV=1
Q9QYV8	DNA polymerase subunit gamma-1 OS=Rattus norvegicus OX=10116 GN=Polg PE=2 SV=1
P54099	DNA polymerase subunit gamma-1 OS=Mus musculus OX=10090 GN=Polg PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002983 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00476 all species →	DNA_pol_A	DNA polymerase family A	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002297 all species →	Family	DNA-directed DNA-polymerase, family A, mitochondria	Interproscan
IPR019760 all species →	Conserved_site	DNA-directed DNA polymerase, family A, conserved site	Interproscan
IPR001098 all species →	Domain	DNA-directed DNA polymerase, family A, palm domain	Interproscan
IPR047580 all species →	Domain	DNA polymerase gamma, palm domain	Interproscan
IPR043502 all species →	Homologous_superfamily	DNA/RNA polymerase superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10267 all species →	DNA POLYMERASE SUBUNIT GAMMA-1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0005760 all species →	Cellular Component	gamma DNA polymerase complex	Interproscan
GO:0006260 all species →	Biological Process	DNA replication	Interproscan
GO:0003887 all species →	Molecular Function	DNA-directed DNA polymerase activity	Interproscan
GO:0006264 all species →	Biological Process	mitochondrial DNA replication	Interproscan
GO:0005739 all species →	Cellular Component	mitochondrion	Interproscan
GO:0008408 all species →	Molecular Function	3'-5' exonuclease activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_034581-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_034581-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

21.0Max TPM

7.9Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.37	12.37
polyp at pH7 6	18	18	10.92	19.50
coral polyp · control treatment	16	16	8.59	13.46
coral polyp · oil and dispersant treatment	16	16	5.14	8.29
coral polyp · oil treatment	16	16	7.61	13.54
coral polyp · dispersant treatment	16	16	7.11	21.03
Polyp	10	10	6.17	10.34

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.37
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.93
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.52
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.11
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.95
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.73
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.52
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.76
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.55
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.38
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.87
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.83
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.71
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.65
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.08
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.68
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.36
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.67
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.50
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.38
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.23
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.23
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.97
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.86
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.36
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.14
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.10
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.85
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.54
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.34
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.14
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.77
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.93
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.64
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.08
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.49
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.46
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.67
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.07
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.49
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.16
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.87
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.53
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.46
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.03
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.47
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.84
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.57
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.50
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.62
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.58
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.08
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.29
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.12
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.57
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.36
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.12
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.05
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.44
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.75
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.35
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.31
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.30
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.21
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.93
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.93
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.37
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.20
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.54
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.68
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.49
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.40
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.21
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.84
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.77
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.67
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.44
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.32
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.21
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.10
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.42
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.69
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.01
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.05
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.03
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.18
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.23
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.25
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.51
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.92
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.22
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.99
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.89
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.87
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.78
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.39
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.89
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.37
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.86
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.42
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	10.34
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.98
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	7.66
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	7.31
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	6.90
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	5.46
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.00
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.64
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.66
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.75

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.