Gene detail

Detailed information of OS493_034611-T1 in Lophelia pertusa

Genomic Location: scaffold_295:386468...390712
NR annotation: KAJ7388973.1, Shieldin complex subunit 2 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_034611-T1

ATGGCGGATCGGTCGGCGGATCGCGATTTATCAAAAACGCCCAACGTTCTCATATTCACCGGCCCGATTGTATGCGTAGATTGCATGCAAAAAGGGTCAAACGTTAAAAGTAAAGAAAGTCAAGGCATTTGTTGGAGAAAATCAATGTTACAGTTAAGTGGAAACTCATTTGTTGCCTGTGATCAACAAAGCTGTAACAACAGTAAAGATTTTGATCTCACTGATGAGAGTGACATCAGGCTCGAATATGACCCTCTAGAAATCCAGGAGTCGGTCTGTTTTTATCTGGAAAGTGAATTTAGGAACAGTGAAAGCTCGTCTCTGCCTTTTGAGTCATCATCATTTGGGTTTGATCCAGCTGAAAACCTTACAAACAAGGAAGATTTACAGAGACAATTTGAAGATATAAGATCTGCAAGTCAAAAACTCCTTGTTGAGAACAGTACTCAAAGTTGTAGCATTTCTAGAATTGGCAACAATAAAGGCGTTAAGAGGAAGACTGACGAAATTCTAGATTTTGATTGCGATACCAACACACATCGGTTGACGATGGAGGACATTTACACACAAGACAAATGCCCGTCTACTTCAAGTAACAGTTGTAGTCCAGTTAACAAAGGAACCAGCGGAATGAAAAACCTAAAACCGACGACTTCCCGAGGGATTTCCGATGTCTCTCCGACGACAAGTCTCGGCAATAGTCATGAACTTGGGATTCCCTTGTGTGATTTCACGGCCGTACCAAGAGTTTGTGAGAAGCTTACTACCCTCAAAGAATGTACCCAAGAAAATTTGTTTGTCAACATACTCTTTGTCGTTCATCAAGTGAATGATACTCGAGAAGTTCAGGTGAAATCTGGTGTAAATGCTGGCAGCTTTGTAGCTCTGTCTTCGCTGGTCATCGCCGATGAATCAAAATCTTGTTTTAAGATAACGTTATGGAGAGAAGCATCGAAATGGACTGATAAAATAACCCCGGGAGATTTTGCTGTTGCTACATCAATGAAGATTGGAAAATGGCGGGACGAATATGTCGCGCAGACCACATTCAACTCGGGTTTCTATAACCTTCATCAACCCAAAGGCCTTCTCTCAAACAATTGTCTAAAGTTAGTTTCGCAAATACGACTTGATGCCCTTGTTAGATGGGTTAGGTCAGAACACCCTTATCTTCTTGTTACGTATCATACAAAGAAAAGTGTTGAGTTTACTGAAATTCCTCAACTACGCGATAACACCTTGGTTCACTATAGGGGTCGTCTGATTAGCATTCACAGAAACTCTTCGTCATCGAGTACTTATCGGTTTGGCGGACAACAGCTGACTAAAATTACAGCAGTTTTAGCAGAGCGGCCGAGCGATAAAATAGAGCTCTTCCTCTGGGGCAGGCAGGCCGCGTGGATAAACCAGCTACAAGAAGGACTGGGGCAAGTTTGGGAATTCCAGTTCCTCACGGCCAAGTACAGCAGTGAAAGTGGGTGTGTGTCTCTTCACTCGACGCCAAGATCAACAAAGTCAAAACTGTCTCCGAAAGACAAGAATGCCCATTATATAATGTCGCGATTTGACGAAGGTGCCGAGGATTGCGAGGAAGCGAAGAAATTCGCAAACCTGCGTGATTTGCTGGAGGCGAAGTACACGGGCTTGGCCGAAGTAGGAGCTAGGATTTCTTCGTTACAATTTCACTGTGAAGATGAGGTCATCATTTTAGACCAAAACGGATCCGTAAGAGATCAACTGAAAAAGAAGCTTGTTAAATTAGTGTACATTGGTTGTGGCTCATGCTACCGTGCTCTTGTACAAGATCAAAACGGCATTTACGGTCAGTGCTCGTATTGCGTCGTCACAAATCCTCATTACAAATACACTATAGGGCACTACTACAAGCCGTTGACGATTTGCCTCAGTGACCATCACGTGTCCGTAGAAGTGGAAGCATTCAGCAGCGTGATTTCCCGCCTCTTTCGAGATTTTCCCGCCAAAACATTGCTGCAAAGAACCGCGGATGCGTCGTCACGTTACCATAGTTACGTGGCTAGTTTTATTGAGCACCTGGAAGTACTTGTTAATGGCGGCCAATGTAAGGCATTCATTTTGTGCCGAACAACTCTCGACGAAAATAGTTTTATCGAGAACAGAAGTTTCACTCTTCGGCAAATCGATTTCTAA

Transcript

OS493_034611-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0009145 (this species only) · gene tree & orthology

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF15793 all species →	SHLD2_C	Shieldin complex subunit 2, C-terminal	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR012340 all species →	Homologous_superfamily	Nucleic acid-binding, OB-fold	Interproscan
IPR029715 all species →	Family	Shieldin complex subunit 2	Interproscan
IPR031589 all species →	Domain	Shieldin complex subunit 2, C-terminal domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR14495 all species →	SHIELDIN COMPLEX SUBUNIT 2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0010569 all species →	Biological Process	regulation of double-strand break repair via homologous recombination	Interproscan
GO:0035861 all species →	Cellular Component	site of double-strand break	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K26129	SHLD2; shieldin complex subunit 2	-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_034611-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

108TPM > 0

7Conditions

10.4Max TPM

2.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	2.70	4.23
polyp at pH7 6	18	18	2.11	3.36
coral polyp · control treatment	16	16	2.77	10.43
coral polyp · oil and dispersant treatment	16	16	2.15	9.94
coral polyp · oil treatment	16	16	2.66	4.60
coral polyp · dispersant treatment	16	15	1.52	4.82
Polyp	10	9	2.04	3.73

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.23
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.99
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.82
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.71
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.59
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.96
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.96
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.94
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.53
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.27
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.15
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.12
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.98
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.92
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.91
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.80
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.76
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.36
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.16
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.69
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.69
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.13
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.10
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.06
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.06
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.98
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.94
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.88
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.83
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.80
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.79
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.74
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.62
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.61
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.59
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.43
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.56
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.25
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.21
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.20
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.78
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.54
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.14
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.09
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.03
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.03
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.69
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.65
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.63
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.56
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.46
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.94
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.19
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.85
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.63
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.61
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.57
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.32
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.25
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.25
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.24
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.88
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.69
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.59
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.50
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.48
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.34
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.60
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.47
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.19
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.17
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.92
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.82
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.51
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.11
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.07
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.89
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.78
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.68
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.50
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.18
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.03
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.70
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.82
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.28
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.90
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.88
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.85
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.64
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.64
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.46
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.31
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.14
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.80
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.61
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.51
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.45
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.03
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	3.73
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.90
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.87
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.70
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.35
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	2.28
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.70
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.63
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.22
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.