Gene detail

Detailed information of OS493_034708-T1 in Lophelia pertusa

Genomic Location: scaffold_297:252551...292724
NR annotation: KAJ7376431.1, Mitotic spindle assembly checkpoint protein MAD1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_034708-T1

ATGAATATACTCAGAACTCCCGATGACAGCACTGCTTTTGTAAGAATCATGGGCGAATTCGATCAGTTTTTGTCCAGTGACCCTAAAATCCGCTTGAGCTACGAAGACTCGTCAAGTGGTGGCGCACCGGCTGCAAGTTCCACAAGGACTCTCAGTAAAATACGAAGCCAAGGAAGTCTTCTATCTAAGGAGCGAGAAAAGGATGTGGAGCTCATCAAAAACCGCAGCAAAATTGCACATTTAGAAAGTCAAATGAATTCACTGGAATCCGAAAGAAAACGCGCTAGAATAGAATATGAAAAGGACTCTGGGAATGAGAAGCTGGGACTTCGTAGACTGGAAGAGAAATACGATGACTTGCAGCAAAACTTTCAGTACATTGCAGAACAAGAGAAAAATGCTAAAGATCAGTTGAAAGAAATTAAAAAGGAGTATGAAACTTACCGGAACAAATCTGAGCAAAAAGTACAAAACTTGCAGAGGGAAAAGCTGAAAGTGTGTGCAGAAAGAGATGAGTTACAAGAGGATACAAGTAAACAGCAAATGGAGTTGAAGAATGCTTTATTCAGACAGGGAACTGAGAAAGCTGTAATACAAAATAAACTGGAGGATACTGAGAGCCAGCTTGAAAATGTCAAAAGAAGACTGAGCGAGGTGATGATTCAACTACCAGAACTGGAACAGCTCAGAGAACGATCAAGAACAGCTGAACACAGAGTCAAAGAATTAGAACAGAAGTTGTCCCGCCAAGATGAAGCTACAGGAGTTGCTATGGTGATGCAAACACAGCTTGCAAAGGAGACAAATGAAAGCAATCTTTTGTTGAAAGAAAAGGCAGACAGTTTGCAAGGAAAACTCCAGCGGGCAGAGCAGCGGATTACAGAATTGACAAGAGTGGAGATTGAAAATGAGGAACTAAGAAAGAAAATCCAAAAGTGGGAGACTGAAGATATGTCAGGGACGAAAAGACTGAGATCGCCAGCCCAGCTTGCACAAGATGTTGCAAATCTTCAAAAGAGCCAGGTTGTGTTGTTAGAGACACAGAGTGAACTGAAATCTAGTGCACATATTCATGAGACAGCATACCAGAGAGCAGCCCAGGAGCTGACAGCTGTGAAAAAGGACTTAGTTGAAATGAAGGAAACTGGTGATCGTCAAAAAGAACTGAATCAAAGACTTCAAAGACGCTTGTTTCTCGTCACTGCTGAACTTGATGGTTGCCGCAGAATTCTTCATACTTACGACAACAACTTCTCATCAAACTATGATCCTCAGATACATGCCAGATTACAAGAGGCCGAAGCTCGTCTTAAAACATGTCATGAACACATAGAAACTCTGGAGCTTGAGTTAAACCAGAAAGCAGAGCATGCAAGCAAGGAAAGAATGAAGTCTGATAAACTGGAGGTTGAAATCAATGAACTGCGTGGACAAGGCCACCAAGCAAACTCCAAAACAGAACTGGAAAAACTGCGAGCAGAGAATGCCAAGCTACAGGAGCAGCTTGAGGTTTACGAAATCAACAAAGAACAAATGCACATACGGGGTTACTACGATCCAACCAAAACCAAGATAGTCCATCTGTCAATGAATCCATCAAGCCTCGCCAAACAGCAGCGCGGAGAGGAACTGGAGAAACTGAGGAAGGAGAATGAATCGCTGAGGAGGAGACTTCAGGTCCTTGAGGAGGGAGGCTGCAGCCCTGAGGATGTGAGTCTTCTGAGCAAGCTCAGTCCAGAGGCCGCACCAAGTGTGGTCAAACAAGTGGAAGATTTCAAAGCTCAACTCTCCTCAGCAGAGATGAAAAATCAGCGATTAAAAGAGGTTTTCAAGAAAAAGATTCAAGAGTTTCGCGAGGCTTGCTATGCGTTAACAGGATTCAAGATTGACGTTATACGAGACAATCAGTATCGGCTTCAGTCCATGTACGCCGAGAGATCAGCAGATGATCTGTTATTTGAAAGCAGTACCAAAGGTGAAATGATGCTTCTGGCCACTGATTTCTCGTCTCAGTTAGCGGATCAAATAGAGACTTACTTGAGCAGATACAATTCCATCCCTGCCTTCCTAAGCATGATACTGATTACCTGGTACTTGCGTAGAAGAACTTTAAAGGGCCCAAATTCTGGAGAAGAACCAACGGACACGGAACGTGAGAAAATCGAGTCGCTGACAGCTGAACAGAAGAATGAAGATGATGATGAGATAACGTTTGAAGAGGCTGCCATCTTTCTGCGAGGTGCAGGCATTATAAAGTCAAAAGACATCCGGTACCTCCCAGAGGATGAAAGAGAAAAATTGGCAAGGGAGGGTACTAATCAGCCCATAACAGAAGAGGAACAGAAGAATAGAATCAAGGAAATGACCACAAAGGATGCTTCTAACATCCAGACTTACTACAAGTCATCTAGATTGGGTATCAAGAGATTTGGTCTTCCGTTCATTGTAAGAGTTCTCAGGGAACTGAGCTATGAAAATCTACAAGCAGCAATGTTGAAAGCCATGTCAAGGATTCTGTTCGATAATGTTTCATCACAGGTTAAGAAGCAAGGCTTGCTGTTTCGACTGCGTGTGGTTAATGGGTTGCCCGGGAAGAGTGCTCTCTCTCCAGAGGTGGATCATCCTTTGTATCAGGCCACTGTTGACAACTTTGTGAAGTCCAGTGTTTTGCAAGAAAGACCAGAGGAACACTGCAGCGTGCGTGAAGTGGAGTCTTTACATAACAGCTCACATAATGTTGGACTGGAGGACTGCTTTAAGCTTTACACCAAAGACGAAAAGTTGGGCTCTGAAGACGCTTGGCTTTGTCCTCGGTGCAAGAAGCTACAGCAAGGCACAGTGAAGAGACTGAGTCTGTGGACTCTGCCAGAGGTGTTGGTGGTTCACCTCAAGAGATTTAGACAGACCTCTGCCGGCCGCACCAAACTCCACACACTGGTGGACTTCCCTCTGATGGACTTAGACATGAATGCACACTTAGAGCCTCGTAACAAAAAGGTCATCTCCAGTGGGCACATGGCGGCGTCAACGTGCCAGTTCCATGACGTGGGTCTGAGGAAAACCTGTATGACCTGTATGCTGTGTGTAACCACACGGGAGGTATGA

Transcript

OS493_034708-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q80YF0	Mitotic spindle assembly checkpoint protein MAD1 OS=Cricetulus griseus OX=10029 GN=MAD1L1 PE=2 SV=1
Q9WTX8	Mitotic spindle assembly checkpoint protein MAD1 OS=Mus musculus OX=10090 GN=Mad1l1 PE=1 SV=1
Q9Y6D9	Mitotic spindle assembly checkpoint protein MAD1 OS=Homo sapiens OX=9606 GN=MAD1L1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0005177 (this species only)
Ubiquitin family	DUB\|USP\|USP · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF05557 all species →	MAD	Mitotic checkpoint protein	Coiled-coil	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR038765 all species →	Homologous_superfamily	Papain-like cysteine peptidase superfamily	Interproscan
IPR008672 all species →	Family	Spindle assembly checkpoint component Mad1	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23168 all species →	MITOTIC SPINDLE ASSEMBLY CHECKPOINT PROTEIN MAD1 MITOTIC ARREST DEFICIENT-LIKE PROTEIN 1	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000776 all species →	Cellular Component	kinetochore	Interproscan
GO:0005635 all species →	Cellular Component	nuclear envelope	Interproscan
GO:0007094 all species →	Biological Process	mitotic spindle assembly checkpoint signaling	Interproscan
GO:0051315 all species →	Biological Process	attachment of mitotic spindle microtubules to kinetochore	Interproscan
GO:0072686 all species →	Cellular Component	mitotic spindle	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_034708-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_034708-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

22.8Max TPM

5.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.96	6.07
polyp at pH7 6	18	18	4.24	6.17
coral polyp · control treatment	16	16	7.24	22.80
coral polyp · oil and dispersant treatment	16	16	5.70	15.65
coral polyp · oil treatment	16	16	5.60	9.06
coral polyp · dispersant treatment	16	16	5.80	9.20
Polyp	10	9	2.86	5.20

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.07
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.54
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.50
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.46
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.09
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.07
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.03
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.68
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.62
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.52
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.47
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.24
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.15
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.69
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.37
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.32
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.80
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.60
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.17
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.76
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.55
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.48
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.39
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.28
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.04
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.79
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.79
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.37
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.76
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.69
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.46
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.80
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.77
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.45
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.45
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.25
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.80
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.56
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.46
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.31
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.97
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.82
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.79
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.78
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.98
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.98
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.84
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.09
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.57
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.34
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.83
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.72
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.65
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.15
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.60
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.56
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.95
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.89
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.77
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.65
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.17
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.56
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.46
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.40
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.27
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.08
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.40
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.57
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.06
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.28
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.05
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.60
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.58
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.45
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.02
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.99
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.36
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.36
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.04
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.74
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.05
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.05
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.34
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.65
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.20
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.66
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.06
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.48
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.41
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.27
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.95
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.44
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.20
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.08
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.05
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.94
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.70
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.51
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.20
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.59
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.20
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	4.41
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	4.35
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	3.65
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	3.27
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.66
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.32
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.99
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.78
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.