Gene detail

Detailed information of OS493_034920-T1 in Lophelia pertusa

Genomic Location: scaffold_303:360863...381424
NR annotation: KAJ7376397.1, hypothetical protein OS493_034920 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_034920-T1

ATGGCTCTGGCGAGGGTAAACAGATTGTGGCTGGATAAAGTTGTCGACAACTCAAAGCAAGCGCAATGGATTTACGACATAATCTTCAGCCCCAATGGATCATATATCCTCGTTGCTGCAGGAAACTTAATCTTGGTGTACGATACGGTTGAAGGTGTGTTGGTCGACATGTTGAAAGGACACAGAGATACAGTTTACTGCCTGTCATACGAATGTACTGTTCTCTTCGGAAATGTACATGTTATTTTCATCTTCCAAAAAAATATGAGAGCGTTACCAACATGGGTCGATAAAGTCCATGATAAGGATAGAGTGGAACAATGTATTTACGACCTTGCTTTCAAGCCCGATGGTAGTCAACTCATCGTTGCCGCTGGAAACCGTGTTCTGGTTTATGATACAAATGATGGAACACTAATTCAGCCACTCAAAGGTCACAAGGAGACGGTTTTCTGTGTTGCTTATGCGAGAGATGGTAAAAGGTTTGCATCTGGGGGAGCTGACAAAAGTGTGATTATTTGGACATCTAAACTAGAGGGAATTCTAAAGTACACACATAATGATTCTATCCAGTGCCTTGCTTATAATCCTCTCACACAACAACTTGCCAGCTGTACAACAAATGATTTTGGTCTGTGGTCACCAGAACAAAAGTCTGTTCAGAAGCATAAAGTATCTTCTAGAGTAACTGCGTGTAGTTGGACAAATGATGGGCAGTATCTGGCTCTTGGTCTTTTCAACGGATTTGTTAGCATAAGAAATAAGGGTGGCGAAGAAAAAGTTAAGATAGAGAGACCAGGTGGAAACCCAGTGTGGACTCTCAGCTGGAATCCTTCCAAGGAAGAACCCTATGACATTCTAGCTGTGGGAGATTGGTCACAGAAGCTATCTTTCTATCAGCTCAGTGGAAAACAGGTTGGAAAGGATCGTCACCTCGGTTATGATCCATGCTGTTTGAATTTCTTCTCCAAGGGTGAATACCTTGTCATTGGAGGATCGGATAAAAAATGCTCACTTCACACAAAAGAAGGCGTTTGCCTGACATCTATCGGAGAACAACAGAGCTGGGTTTGGTGTTGCAGAGTCAGACCTGATTCCAATTATGTGGCACTTGGTTGTCAAGACGGTACAATAGCTTATTATCAACTGATCTTTAGTACTGTTCATGGCCTATACAAAGACAGGTATGCCTTCAGAGACAACATGACAGATGTTATTATTCAGCATTTGATAACAGAACAAAAAGTTCGCATCAAGTGTCGAGATTTAGTGAAGAAGATTGCCATCTACCGACACAGGCTGGCTGTTCAGTTACCGGACAAGATAGTTATTTATGAATTGAACACAGATGACATTTCTGATATGCATTATAAAGTCAAGGAGAAGATTGAGCGGAAATTTGAGTGCAACCTGCTTGTTTCTTGTTCCAATCACATTATTCTTTGTCAGGAAAGAAGACTACAGTGCTTAGCATTTACAGGGACCAAAGAGAGGCAAGTAGAGTGGGTGATGGAATCTCTGATACGTTACATTAAAGTGATTGGTGGCCCGTCAGGAAGAGAAGGTCTCCTTGTTGGTTTAAAAAACGGACAGATCATGAAGATATTTATCAACAATCCTTTCCCGTTGCCGCTGCTGAAACAAGAGACAAGTGTTCGCTGTCTGGACCTGAGCACCAACCGCAACAAGTTGGCCGTGGTTGATGAAAACAACACTTGTCTTGTATACAACATCAATAACAATGAGCTGCTCTTCCAGGAACCAAATGCTAACAGTGTGGCTTGGAATACTCATAATGAGGACATGTTGTGTTTTTCTGGTGGTGGTATGCTCAACATCAAAGCCAGTAACTTTCCTGTACATCAACAGAAACTACAGGGTTTTGTAGTTGGTTTTACTGGATCCAAGATCTTCTGTCTTCATGTCTACACCATGTCTGCAGTGGAAGTGCCACAGTCTGCTCCTATGTATCAGTATCTGGAAAAGAAGCTATACAGAAATGCATACAAAGTGGCCTGTCTTGGGGTGACTGAGGGTGATTGGAGAGCTCTGGCTATGGAAGCAATGGAGGGCCTTGATTTTGACACAGCTAAAAAGGCCTTCATCCGAGTGCGGGACCTGAGATATCTGGAGTTAATTCACAACATCGAGGAACGCAAAAAGAGAGGTGAAACAGACGAGCAGGCTTTTCTTGCAGATGTGTATGCTTATCAGGGCAAATTTCATGAAGCTGGCAAGCTGTACAAGAAAACTGGAAATGATGAAAAGGCCATGGAGATGTTTACAGACCTCAGGCAGTTTGAATATGCAAAGGACTTCATTGGTGGCAGTGATCCTAAGAATGTAAAGCAATTGATCAAGAAACAAGCCGAGTGGTGTGAAACAACAAATGACCCCAAAGCAGCAGTGGACATGTTTCTTGCTGCTGGTGAAAATCTTAAAGCAATTGAAATTATTGGACAACATGGCTGGGTGGAAAAGTTGCTGGAAGTTGGACGGAACCTCAACAAGGCAGACCCAGAAGGACTAAAACAGTGTGCATACTATTTCAAACAACTGGATCAGCATGGTTACGCGTCAGAGATGTACATCAAGATTGGTGATATCAAAGCATTGTTGGAACTTCACGTGGAGACTAAACACTGGGATGAGGCCTTTGAACTTGCTGAGAAACATCCTGAATTCAAGGATGATGTGTTCGTGCCTTATGCCAACTGGCTGGCAGAAAATGACCGATTTGACGAAGCTCAGGAAGCTTTCCACAAAGCTGGACGAAGAGACCAAGCTGTTAAAGTACTGGAACAGCTGTGTCACAATGCTGTAGTAGAACACAGGTTTCACGATGCTGGATATTACTTTTGGAAGCTGTCTGTGCAGTGTTTGGACCTGGTCAGCGGAGGAGCTACAACAGACAATGCCCAGGGTGAACCCGATTACGAAATGTTGGAAAAATTCCATGAGTACCAGGAAAAAGCAGAAATTTACCATCTGTATCACTCCATTCAGAGATACACGGATGAACCGTTCACATCCCACCTGCCTGAGACGCTGTTTAACATCGCTCGCTATCTGCTGCATATACTGGTGAAGGAAATCCCACCAGGAGTCTCCAGAGTGTATCCTTTGACGTAA

Transcript

OS493_034920-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6NYH1	Intraflagellar transport protein 122 homolog OS=Danio rerio OX=7955 GN=ift122 PE=2 SV=1
A8WGF4	Intraflagellar transport protein 122 homolog OS=Xenopus tropicalis OX=8364 GN=ift122 PE=2 SV=1
Q6NWV3	Intraflagellar transport protein 122 homolog OS=Mus musculus OX=10090 GN=Ift122 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002779 (this species only)
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|CDC20 · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00400 all species →	WD40	WD domain, G-beta repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR039857 all species →	Family	Intraflagellar transport protein 122/121 homolog	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12764 all species →	WD REPEAT DOMAIN-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0030991 all species →	Cellular Component	intraciliary transport particle A	Interproscan
GO:0035721 all species →	Biological Process	intraciliary retrograde transport	Interproscan
GO:0060271 all species →	Biological Process	cilium assembly	Interproscan
GO:0061512 all species →	Biological Process	protein localization to cilium	Interproscan
GO:0097730 all species →	Cellular Component	non-motile cilium	Interproscan
GO:1905515 all species →	Biological Process	non-motile cilium assembly	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_034920-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_034920-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

98.5Max TPM

36.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	34.10	48.73
polyp at pH7 6	18	18	31.02	43.82
coral polyp · control treatment	16	16	48.66	98.50
coral polyp · oil and dispersant treatment	16	16	35.80	80.65
coral polyp · oil treatment	16	16	42.86	51.30
coral polyp · dispersant treatment	16	16	30.11	50.93
Polyp	10	10	27.38	48.34

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.73
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.15
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	46.30
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.93
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.24
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	41.29
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	40.18
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.90
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.47
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.01
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.82
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.90
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.70
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.27
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.52
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.84
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.40
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.04
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.82
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.58
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.51
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.49
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.12
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.56
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.27
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.90
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	30.48
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.87
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	29.78
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.79
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.04
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	26.48
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.05
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	24.92
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	20.71
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.06
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	98.50
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	85.36
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	59.11
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	56.76
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	56.64
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	51.18
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	50.40
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.43
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.04
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.57
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.89
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.71
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	38.44
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.88
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.42
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.17
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	80.65
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.18
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	44.95
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.66
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.49
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.09
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.86
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.92
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.28
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.82
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.64
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.09
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.80
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.58
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.55
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.29
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	51.30
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.41
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	48.37
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.86
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.48
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	45.06
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.28
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.35
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.18
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	42.74
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	40.06
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.87
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.61
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.50
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.29
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	36.31
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	50.93
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	47.10
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.41
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	42.67
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	40.36
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.91
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.73
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.08
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.61
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.91
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.73
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.21
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.17
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.22
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.48
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.27
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	48.34
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	45.05
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	37.91
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	33.35
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	31.73
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	18.07
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	16.33
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	16.18
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	14.54
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	12.34

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.