Gene detail

Detailed information of OS493_035039-T1 in Lophelia pertusa

Genomic Location: scaffold_307:181454...198777
NR annotation: KAJ7388892.1, hypothetical protein OS493_035039 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_035039-T1

ATGAGATTTCAAACGTTCAACTGTCTATTTTGGGGATTTTATCTGTGGATTTTGTCTGGAAACCTTCTCTCGGGATTCCAACACAAGCGATCGCTTGATTCTCCGAGCTCACAATTGTCAAATCACACAAAGTCTTGTCCAGATTGCAAAGCACCAACATTTGACAGACCTCTTCAAAATCAAACGGTAGTGGAGAATGGCAAGGCATTGTTTAAGTGTTACGTGAGTGGCCTTCCAAAACCAGATGTTACGTGGTACAAGGATGGAAAAATAATAAGAAACAATCGTGAATCATTTGTCATTATTAAAAGGGATCGTAGCTCAAGACTTAAGAATCGGCTTGTACAGTTGAGTGATGCTGGAATCTATACCTGTGCGGCAAATAATTCATATGGAACGTCAAGAATACAAGCTTTTCTTGTTGTGAATGAAAGCATAAAGCCTACAACAGCTCAAGACAAGACAACCCTTGAAAACAGAACACCTTTGCCTTCCATTCCTCTGCCTACCAGTAGGACAACCACATTATTAACTACACAAGAGGTTTTACCTGAATACCCAAAACAATCTAATCCTCGACACAATGGATATGACCAGGGAAAAGATAAACCAACAACTAGTGATTTGGAAATACCTACACCACCCGCTCTCCCAGAAAATGGCACTTGTGTCATTTATAATGGCTCTGTTTGTTCCAAGCTCTTGAAGGGACGACCAATCTACATAAGAAGTTATGAAAGACTAGAAAACATTGAGAATAAACTCAGCACTGCGTATAGCACCATACAGACATTTGACAAGATCAGTGATCGCTGCCGGCCTTATGTACAACCTCTATTGTGCCATTATCAGTTCCCAAGCTGCGACAAAACATCTCCTGTGCCACGTCCACGGCAGATTTGCTATGAGGAATGTGACATCCTTCGTAGCACGATTTGTCCAAAGGAGTATATTTTAATGCAAAGAGAATCATTGCAGCATATCCTGTTCCCAGAGTGTTCCACTTTGCCTCGTGAAAGTTCAAAGAAAGGCAAGAATTGTATAAAACTGGGAGTCAGTGGACAGAGGAATCATAAGCCAATTGAGGAACGAAGTAAAGCTTCACCGTTTACTGGATGCTTCAATGGTAAAGGAGAACATTTTCGTGCCAATGTGAGTGTCACAGAAAAAGGGCTTGTCTGTCAACGGTGGAACTCTTCTACTCCTCATCACCACATTTTATCATCAGAGGATTATCCAGAGCTTGCCGGTGGACACAACTTTTGTCGAAATCCCGGAGGAAAAAAGAAGAAACCCTGGTGCTTCACAACTGATGCTGACACCAAGTTTGATTTCTGTGATATTCCCAGTTGTGATGATCCGTCCGCCATCCCACCGCCTGTACAGGTCGTGAGCATCTTGTACACGGTTATTCCGTGCTTGCTGTTCGCCATCATCTTCTCTTCAGTTGTGATCTTAATCTGTTGGAGATATCATAAACAGATCATCTACCAAGCCGGCCAGTCAGCGGCTACACCTCTTGTGCCTGTTGTTGGTAAACCGGCTTACCCGAAGATCAAAGAAATGCGTCGAGAGACTGTCAGATTTCTTAAGGATTTGGGTGAAGGCGAATTTGGCAAACTGTACAAAGGCGAAGTTTTGGAGAAAGTTGACGGCGTGCAGACAACAAGAGCTATCTTGGCCAAAGTCCTCCGAAACAGCTCGTCCGCGAGTAACCGGGAGTGCTTCTTGCGCCAAGCGGAGACTTGGTCCAAGTTTAGTCATCCTAACGTCATTAGTATCATTGGCATGTGTTATAACGGGCCTCCGACGTGCATCTTGTACGAGTGCGTAGAATATGGTACATTATTTGATTACCTCATTGAGAACTCGCCGCTGGAGAGCCCGGATGATGATGACGACGATCCAGAACCCCTGAGTTATTACGATCAATTACAGATTGCAATTCAAGTAGCTGCTGGAATGAATTACGTGTCACAACATAATTATATCCACGGAGACTTAGCAGCGCGGAACTGTATGGTAGGGCCTCGTATGACTGTCAAAATAACGGACGTGGCGTTATCACGGAACCCTTTTATACACGACTATCATCGTACTCCTAATAGGCCTCCTATGCCCCTACGTTGGATGGCCCCTGAAGGGGTCCTTAATTACAGGTTCACCGTAGAGACAGACATATGGTCCTTTGGAGTGGTCCTGTGGGAAATATTTTCGTTTGGTTCGAAGCCCCATCAAGGGTACTCGGACGAAGAAGTCATGGAGCGTATTAGAGAACATGTTTTGTTACCTTGTCCTAGTGACTGTCCTCCAAGAATTTTCGTTTTAATGAAGGAATGCTGGGACATCTTGCCTCCAAGCAGGCCGCGGTTTAGTACGATTTATACTCATCTTTGTGCACTGAGATGGGATACGAACGGACCACGTGACCTGCACGGACCACGTGATTCACACGAAACATGTGACAGAGAATGCTTTCATGTTGACGTATGA

Transcript

OS493_035039-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q01974	Tyrosine-protein kinase transmembrane receptor ROR2 OS=Homo sapiens OX=9606 GN=ROR2 PE=1 SV=2
Q9Z139	Inactive tyrosine-protein kinase transmembrane receptor ROR1 OS=Mus musculus OX=10090 GN=Ror1 PE=2 SV=2
Q01973	Inactive tyrosine-protein kinase transmembrane receptor ROR1 OS=Homo sapiens OX=9606 GN=ROR1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001743 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF07714 all species →	PK_Tyr_Ser-Thr	Protein tyrosine and serine/threonine kinase	Domain	Interproscan
PF07679 all species →	I-set	Immunoglobulin I-set domain	Domain	Interproscan
PF00051 all species →	Kringle	Kringle domain	Domain	Interproscan
PF01392 all species →	Fz	Fz domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR008266 all species →	Active_site	Tyrosine-protein kinase, active site	Interproscan
IPR001245 all species →	Domain	Serine-threonine/tyrosine-protein kinase, catalytic domain	Interproscan
IPR000001 all species →	Domain	Kringle	Interproscan
IPR020067 all species →	Domain	Frizzled domain	Interproscan
IPR018056 all species →	Conserved_site	Kringle, conserved site	Interproscan
IPR036179 all species →	Homologous_superfamily	Immunoglobulin-like domain superfamily	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR050122 all species →	Family	Receptor Tyrosine Kinase	Interproscan
IPR041775 all species →	Domain	Ror-like, cysteine-rich domain	Interproscan
IPR007110 all species →	Domain	Immunoglobulin-like domain	Interproscan
IPR013806 all species →	Homologous_superfamily	Kringle-like fold	Interproscan
IPR036790 all species →	Homologous_superfamily	Frizzled cysteine-rich domain superfamily	Interproscan
IPR038178 all species →	Homologous_superfamily	Kringle superfamily	Interproscan
IPR013098 all species →	Domain	Immunoglobulin I-set	Interproscan
IPR003598 all species →	Domain	Immunoglobulin subtype 2	Interproscan
IPR003599 all species →	Domain	Immunoglobulin subtype	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24416 all species →	TYROSINE-PROTEIN KINASE RECEPTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0004714 all species →	Molecular Function	transmembrane receptor protein tyrosine kinase activity	Interproscan
GO:0005887 all species →	Cellular Component	plasma membrane	Interproscan
GO:0007169 all species →	Biological Process	cell surface receptor protein tyrosine kinase signaling pathway	Interproscan
GO:0007275 all species →	Biological Process	multicellular organism development	Interproscan
GO:0010976 all species →	Biological Process	positive regulation of neuron projection development	Interproscan
GO:0014068 all species →	Biological Process	obsolete positive regulation of phosphatidylinositol 3-kinase signaling	Interproscan
GO:0017147 all species →	Molecular Function	Wnt-protein binding	Interproscan
GO:0033674 all species →	Biological Process	positive regulation of kinase activity	Interproscan
GO:0043235 all species →	Cellular Component	receptor complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_035039-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_035039-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

59.9Max TPM

28.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	36.66	52.77
polyp at pH7 6	18	18	36.28	57.57
coral polyp · control treatment	16	16	27.23	37.22
coral polyp · oil and dispersant treatment	16	16	20.03	28.03
coral polyp · oil treatment	16	16	27.64	37.93
coral polyp · dispersant treatment	16	16	20.99	39.70
Polyp	10	10	23.09	59.93

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	52.77
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	50.79
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	49.74
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.10
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.43
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	44.70
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.17
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.95
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.91
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.84
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.83
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.25
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.68
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	31.64
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	29.19
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.62
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.92
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.38
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	57.57
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	49.59
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.84
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	43.19
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	41.91
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.72
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.90
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	37.10
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.18
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.78
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.74
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.61
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.40
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.71
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.40
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	27.70
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	25.46
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.32
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	37.22
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.41
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.18
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.41
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.41
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.22
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.56
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.19
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.89
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.39
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	26.08
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.54
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.66
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.27
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.13
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.19
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.03
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.23
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.88
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.27
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.22
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.77
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.15
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.11
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.27
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.02
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.26
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.12
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.93
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.59
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.45
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.13
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.93
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	37.50
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.82
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	35.67
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	34.46
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	33.98
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.38
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.20
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.40
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	25.22
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.83
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.74
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.05
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.48
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.53
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.07
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.70
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.69
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.36
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	29.46
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.86
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.64
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.99
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.51
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.93
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.45
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.11
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.04
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.79
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.04
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.33
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.96
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	59.93
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	33.85
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	33.39
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	22.23
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	18.56
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	18.02
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	17.79
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	11.46
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	8.26
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	7.42

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.