Gene detail

Detailed information of OS493_035209-T1 in Lophelia pertusa

Genomic Location: scaffold_313:283280...306271
NR annotation: KAJ7388869.1, Sortilin [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_035209-T1

ATGCCTGTGGTAGAAACAATTCTTCCTTTCCTTTTTCCAACACAACACGGGTACATGTATGTGCAGTGGAAGTTTGAAAATGAAACGAAACTAAGCATCTCAATGAGTTGGATCGGCAAACGAAATACAGGGGAATCTTCGGCAATGCTTCTTTGGCCACAACAGAGTTTATGTTTCTGTTTAGCAAGCCGTCAGAAACTCTATAAAAGTGATGACTTTGGAAAAACATTCAAACGCATCAATGCTGAAATTTTCAATACACATATCAGAAAGGATAGCGGAATCATGAAAAGCCCAGTCAATCCTAAAAAGGTTTGTTCAATAAGTGATTCTTGTGTCCCACAGTATTCCATTTTCCCATCCACATCTGGCATTGTGATGACTGAAGATGGTGGAGAGAGTTGGAGAAAGATTAAAGTTCCGTTTCAGATCAGTGGACCACTTCTGTTTCATCCGCATGAAGAAAACTGGATCCTGGCCAGGGCTGTGGTTAACGGGATGGCGTACTTATCAAAAGACTTTGGAGTTACCTGGACATTTTTGCAGAGTTATGTACGGAGCTTAAAATGGGGTGCCAGAACAGACGAGAAAGTGGAGAAGGAAGAAAAAACAATTCTCATGACAGTCTCAACTGATGCTCACCACTTCTTGATGGGAGATGCTAACTTGATCAGATCAAGGGATCTCGGAGAGCATTTTAAGTCGATCCACGTTCAGCACGTTTACTCCTTTGGACTTCAAGGACAGTTCCTATTTGTCTCTGTGGACCACAACAAGAATAACAATACACGCATTATGCATGTGTCAAAGAATGGCGGGGATTCCTGGGACCCAGTACAAGTGCCGACAGTCACACCAGAAAGGTTCTATTCCATCTTGGACATGTCTGAAGGATTGATTTTTCTTCATGTTGATGACCCTGGAGATACTGGAAGAGGAGTATTGTACACTTCAGATGCTGATGGAATTGTGTTTAGTGAATCTCTCCGAAACCATGTGTATACAAACTTCTTAGAAGTGAATGACTTTTACAAGGTGGAGTCTATGAGAGGAACATACCTTACAAGCCGCATGAACGATGATAACAGTGTCTCTACATTGATAAGCTATGATCGAGGCGGTGAGTGGAAAACTATTCCCTTGACAAAGGAACAATGCAACGGAGCCAAGTTGGAGCAAAATGAGAAGTGCTCACTCCAGATCCACAACCGTTTCAGTCGCAGTAGGATGGTTGATGTTCCCATGGGCCCTTTGAGTGTGCCGAATGCTGTCGGTATCATTATTGCTCATGGCAACCCAGGTACTGCCTTGAGCAGACACATAGATGTGTGGATGACGCGCAATGGAGGCTACACATGGTATAAGGTTCTGACTGGTCCTCATCATTACTCTATTGGAGATCATGGCAGTTTAATAGTAGCAGTTCCTGCACACTCAGAGTCGACTACCAATTACCTCATGTACTCAGTGAATGAGGGCCGTTGTTGGTTTAAGTACCGTTTTACAGAACACGAATTCCATGTGACTGGGCTGGTCACTGAACCAGGGGCCAAGACAATGAGGTTCAGTTTGTGGGGCTCAACTTTGCCGTCACGAGAGTGGGAGGTCATCACTGTGGACTTTGAAAAAGTGCTGACAAGAGCTTGTAAGGATGGTGTTGATTATGAAAAGTGGGTTCCTCACGGTGAGGGTGCAAACAGTGGATGTCTGCTCGGCAAGAAGGTTTCCCTTCAGAGACCCAAGAAAGAGGAACTTTGTTTTAACGGAGTGGATTACATTCAAAAGCAGACGGCTGAATGTTGCAAGTGCACACAGGCTGACATGGAATGTGATTATGGATACTACCGACGACCAGATACTCCCAAGTGTCTCCGGGACAAGAGAAAGCCTCCTGATCTCTGTATTCACGGCGACACAGAGAAACTAAAAGACAAATTAGGATATCGTCTTGTTCCTGGCGACGTTTGCTGTGGAGGTGACCCAGTAGTGAAAGGATATTTAGACACACATCAGATCTGTAAGAATGCGTCCTGGTACGAGTACGGAATGGACTACAAAAAAGCACATACAGCCAAGAAAGGGCACAGCAGGGTTGTCGTGTTCTTGGTTGTGCCTATGCTGTTGATTGTTATTGCTGCAGCCGCGTACTTCGGCAAGAAGTACTGGGACCTTGGCAAGTTCCGTCCTACCTATCGCTACTCGCAACTGTCACAAGAAGATGAGGAGGATTTAGAAGGGTTAGAAACTAAGTACAACCCCAGACCCAAAGGATTGCGGGCCTATCGGGATTACGACACAAGTGATGACGATGCGGCCATGATAGACTTGTGA

Transcript

OS493_035209-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q99523	Sortilin OS=Homo sapiens OX=9606 GN=SORT1 PE=1 SV=3
Q6PHU5	Sortilin OS=Mus musculus OX=10090 GN=Sort1 PE=1 SV=1
O54861	Sortilin OS=Rattus norvegicus OX=10116 GN=Sort1 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000636 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF15902 all species →	Sortilin-Vps10	Sortilin, neurotensin receptor 3,	Repeat	Interproscan
PF15901 all species →	Sortilin_C	Sortilin, neurotensin receptor 3, C-terminal	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006581 all species →	Domain	VPS10	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR031778 all species →	Domain	Sortilin, N-terminal	Interproscan
IPR050310 all species →	Family	VPS10-related sortilin family receptors	Interproscan
IPR031777 all species →	Domain	Sortilin, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12106 all species →	SORTILIN RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005794 all species →	Cellular Component	Golgi apparatus	Interproscan
GO:0006892 all species →	Biological Process	post-Golgi vesicle-mediated transport	Interproscan
GO:0006895 all species →	Biological Process	Golgi to endosome transport	Interproscan
GO:0006897 all species →	Biological Process	endocytosis	Interproscan
GO:0016021 all species →	Cellular Component	membrane	Interproscan
GO:0016050 all species →	Biological Process	vesicle organization	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_035209-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_035209-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

90.7Max TPM

41.3Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	37.04	59.77
polyp at pH7 6	18	18	36.42	48.54
coral polyp · control treatment	16	16	54.87	90.66
coral polyp · oil and dispersant treatment	16	16	46.87	70.35
coral polyp · oil treatment	16	16	49.52	83.25
coral polyp · dispersant treatment	16	16	39.88	62.12
Polyp	10	10	16.63	31.16

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	59.77
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	59.13
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	49.23
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.29
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	44.29
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	43.96
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	40.74
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.63
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.00
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.35
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.67
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	33.29
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.48
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.69
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	27.34
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.93
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.86
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.08
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.54
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	46.37
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.74
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.58
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.47
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	45.23
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.84
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	44.27
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.68
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	40.35
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.82
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.40
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.65
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.70
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.79
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.36
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.31
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.55
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	90.66
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	80.32
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	71.07
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	69.63
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	63.83
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	56.93
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	56.17
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.99
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.19
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	53.01
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.76
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	49.41
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	43.21
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.31
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.66
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.72
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	70.35
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	69.09
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	63.94
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	62.66
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	60.87
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	56.27
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	50.11
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	47.47
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.22
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	40.37
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.16
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.06
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	35.41
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.20
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.07
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.74
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	83.25
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	65.62
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	61.24
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	60.08
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	57.10
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	56.80
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	54.99
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.40
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.01
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.36
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	46.31
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.31
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.49
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.31
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.95
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.16
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	62.12
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	61.19
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	58.01
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	53.93
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	51.32
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.82
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	46.76
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	44.91
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.74
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.39
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	34.08
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.33
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.15
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	27.50
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.14
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.66
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	31.16
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	28.51
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	27.65
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	20.31
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	19.41
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	11.07
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	10.18
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	7.59
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.96
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	4.47

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.