Gene detail

Detailed information of OS493_035507-T1 in Lophelia pertusa

Genomic Location: scaffold_323:45724...65460
NR annotation: KAJ7351782.1, Structural maintenance of chromosomes flexible hinge [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_035507-T1

ATGAAATCGTCAAATAAAGACGATGCTTCATCTTCTGAGCAGGACGAAGAAGATGCCGCTGTTTATATTTATGATCGCAGAGTTGGAAGCAGGCCGGAAGAGAAGATACAGTTAGGCGGCATATTCAATTTTACTACTTTCAAAGAAAAGACCCGAACAGCTTTCAATATCCCGGAAAATGAAACATTTGTGATTGTGACCACAAATCGACAGGAAATCTTGAATGACAAGACTTACGAAGAGTTGGTTGATGGAAATGAAACACTTTACATCTTAAAATCGGCTGACCAAGAACTTAGCGCTCCAACTGAAGAGAAAGTGGAATATATCCCTCATTATGACACTTTGGTTAAAAGTGGCATGTACGAATATTATGCCAGTGAAGGACAAAACCCATTACCGTTTGCTTTCGCTGAACTGGTCGACAATGCACTTGCTGCCACTGCAGATAATGAAGGAGCTAGGAAAATTGAAATAAGACTGATGTTTGATGACTCTGTTGGAAAAGGTGTCGTCTGCGTCCTTGACAATGGAGCTGGGATGACATCAAAGGAACTTAACAATTGGGCTATTTATCGGTTATCCAAGTTCAATCGCCAGAATGGAAGGAAAGTTGCTGGAGATGTTCCAAGGTCTTTAAACAGTGATATTTCATACTTTGGTGTTGGTGGAAAGCAAGCCATCTTCTTCATTGGAGATGCAACCCGGATGATTACCAAATCAAAAAACTGCAGTGACATCCATGAGCTGTGTATTTCTCAAGCTGAATTTGAGCGACGAGAAAAGAAGAAGGAGTCCATTTATGGTGGTGCTATACTTAACAGGAGGGCTGGAGACCATGATCACATTCCCGCTGATGAGGAAAATGTCAAGAAACTGGTACAGGAAGAGGCACGGAGAGAGAGCTTCACTGCTGTGGTTATAACAGGAATAGCTCCAGCACACATTCTTTATTTGAAAACACATTTCAAACATTGGTGCAGACAATTAGCACACATTTACCATTACTACATTCATGGTCCACGTGGAAATGACAAGCCTGTTGGTAGAGGAACCACTGCAAGCCCATTCAGAAATATTGATATACAGGTTGTTCTCTGTGAAAAAGGTAAACCGGCCAAGAGGGTAGAGCTGCGAGATATTGACGATGACATGCAGACCCAGTACATCAGATCAGCAGCTTCTGTGTTTGAGTTCCGTGCCCGTGCAGAATCAGGTGGAGTTGTAGAAGGTGTCCTGCGTTACCATCCATTCCTTTATGATAAAGAAACTTACCCAACACTTGAAGGAGAAATTCCAGTTGTTGAGAGTGCTGAAGAACTGGCTGAGCCAATTGAAAGAGACAGTCGAGCACCCAGAGGCAGTCGGCCAATATTTGAGTGCTATTGGAATGGACGTCTTATTCCATACACTGCTATTGATGTGCTTGAATGGTGTCAGCCACCAAAGAAGTTGATCATTCCTACAGAGTGCTATCATAGATTTTCTGGTAGCTTGTGGACAAATGATGCATTTCAAGTCAGTACAAACAAGTTAACATTTATGGATCTGGAAGTCAAAATCAAAGACAAGAATACCATTTTCAGCAGAGTCATTTTGGGACAGGAGCAAAGAGTAAACATTGCAAGAGCATTTTATGACTGGGTCAGAGAGTGTCATGAAAACCATGATAAACAGGTCAAGTTCATTGGCTTCCAAGGTCAAATAAAACGCCCAGACTTACCACAGAAACGGAACCAAAGTCCTTGGTGTATTTTTAACTCCATAGAGTGGGATGGAAAGATCTTTAAAGTAGGACAGTTGATTAGAACACAAAGGACACTACCGATGATTTGCGGAACAGTTAAGAGATTTCTTCTTTTTGGTGATCATGATGGGGATGTGTTTGCTACTGGAGGAGAGATGGAAATAGTCCAGGAGCCTGTTTCTTTATATGGAGACACTAAGTTCTTTTCTTTGGCCAAGTTAGATCGATCACTGAACCTTGTTTCGATTAAAAAGTTTGTTGAAGAGGAGGAAGCAAAGTTACCAAGTAAATTGGTGTTAGGGTGGCCAGAAAATGACAAACTTGACCCTAACTCTAAAATACCTGCAGGAACCACCATAGGTGCCATGAAGGTGGATATTCTGAATGGAAAAGGTGAATCTGTCAGCAAACTGCCTGGTGACAGAAGAAGATTGTTGCTAGAACTGAAGGTTATCTGGCATGGAAATGACAAAGATGGAGATAAAGTGATAACTAACCATGTCTGCCAACATGGAGGAAAGAGCTGGCCTTACTGGTTCAGAAAAATGGAGAATATAACCCATCTTGGTCCACATACTCTTCAGCTGCAAGTATTGCTGGGCGACACTTCAACTTCTCCTTCAATAAAGAGTCTTCCATGTCATCGCATCAAGTTCACTGTCACAGAGGCCCATCCAAATAAATTTACTGTTGGAATGTTGGAGACACCACTCAGAGTAGGGGTACCTTTCCAGATTCCTCTTAATCTTCTGGATGAGTTCAACAACCCTTCAAAATTGGCAGATGAGATTTCTCCAGTTTTAAGTGCAAGTGGTCTGGAGCTGACACATCAGGGAACATCAGTGAAGGGGAACAGCCTGATTGTTAAGGGTGTGGTTGCCCTGGGCTCTGTGCCATCACATGCTGGAAAGGACTTTAATCTAAAAATCACCCTACCAGGACTTGAAGAAGGTTCACAGAGCTTAAAGATTAGGTTATTACCAGGTCCTCCAGAATCCTTGGTGGTTACTCCAGATGGTGAGGATATCACTGTTGAAAACAACAGCCCACTTGCAGTTCAAGTACAGGTCCAAGACAAAGCTGGAAACCTAACAGTTCAACCCAGACTTAATGTCGTCTGCAAGTTGATGGGTACACCAGGCCTGCCAACATACATAGGTGACTGCAGCTCCTCAGGGAAGGCCACTCTAACAGGTGCAGATATCACTCTCAAGCAAATTACCAAAAACACAAAACTCAAGGCCAAGATTGAATTACAGCATCACAAGGAAGTTTCTTCAGTGGAGAAGACCATTGTTGTGATACCCAGTAGCAAAGCAGCAGAGCTGGAAGTGTTTCACCAAGCAGCTGATGGCAAACCAAAGAAGACGATAGAAGATGGACAGGAGTTGCTCTGTGTGGCAGGACATATGTTGACTGGATTAAGTTTTAGAATTCTAGATGAAGGCCAGCGAGATGTAAATATTGACAACTCATTGGCCAGCAGATTTAAGGTGAACTGGACTCCTAAAGTTGCTAAAGATATCATCAAGCAAGGAATTCTTCCAGATGTCAAGGCGCCACTGTCTTGTGATGAACCAAAATATTGCCAAGTGAGCATGACTGGTGGAGCAGGACTGGAGTTTTCTTTCACAGTGAGACCTCTTGCTGATGTCCCTAACGTGTTGAAGTGTTCCTGTGATGTACCTCGCATGAGATTAGGGGAACCTTTAGCATGTGATATCATCCTGTCAGTGACTGACAAACATGGCAACAAAACTGGCAAGCTGCCCAGCAATGTATTGCCAGAGTTTCATGTTTCTTCTGATGGATTAAAAGAACGTGAAGTACAATTAGGATTCACTGCTGATGGCAATATAGTGATTAAGAATATTCAATTTGAAGATGGTCCACTGGGACAAAGAGAACTCACCATTAAATGGAGAGATATGAAGTGTTATCAAAGAATAGAGGTTACTGCAGGTCCACCAGCTAAGCTCAAGATTCTAGATATTGATCAGTCCGAGCCACTGTCAGTGTATAATGACACTAGAATGCCAATGCCGTTGACAGTACAACTCTGTGATAAGCTTGGAAACTCTTCTAATGAACCAAATGTTAAGGTGGCTGTTAACTGTGACCGAGGGCTTAAGTTGGCTCCAGTCCCTGCAGGTCAGAAGACAGACAACAAAGGCCAAGCCAGCTTTGGTCATCTCACTGTCAATGCAGTAAGGGGAATGTATGGAATACGAATCAAGGCTCTCCTTGGAAGAACAGCAATAGATGCACCAACAATAAACGTGAGAGTGGAGCCAGACCCATCCAAGGCTGTCAACCTAACTGTGACATTTGACTCCAAGGCTCCTTGCGTGGTAGGAGAGTTGTTACCAGCTGTGTCAGTTCATGTAGTAGGTGAGGATGAGGCTGTGATGAAGGCCGCCAGTGCTAAAGACTTAGTATTAAAGATATGGCACTCCAAGGACGGCCCAGTATCTGACAAACCCCCACCAAGGGCCACAACTTTGTACCCGTCCAAAAGGAAAGTATCAGATAAAGAAGGCGAATTCTACTTTAGGGACCTCAAGGTACCTGATATGGCAGGACCATATTGTATGGTGGTACAGTTTGGATCAGGAGGAGTCGTGACTCTCTCAAGTAACCCGATCACGTTCACTGCAAAGCCTGGGCTCCCTGTGAAGCTTGAACCAGAAACGATTCCAGCCACTCCGACTGTGTCTAACACACAAAGGAACAACGGTCGATTACTGGTCAAGACACTCAAGTTACAGCTCAAGGACAAGTTTGATAACTTGACCGGCGAGAATCTCCGAGGTAAAGTCCTTATTAAGGTGACGACTCCATCAGAAGGTATAGACGAGATTCCCGCCCTGGCTGGGAATGTGGACTACATGGAGGTACCCCTCTTCAGGGGCGTGGCCACTGTTCAGAACCTGCTCATACAAGAAAACACTGCAGGCAAAGATGGACAGGAATATCTACTCAACTTTGATACTCAGATCCCTGCCAATGCCTCGCCTCATCCTATTCCGCCGTTCACATTGGCTTTCTTGTTTTACAATGATGTCAGGAAACAGCAGCAGATGGCTCAACTAACAAAAGAAAGAGATCACTTGTTTGAGACGATTCGCACGTATCGCCTTCTGTTTGAAACTACACGACAACTCATCAATGAGATGCAAGTTTCAGTACACGAAGCCTCTTTACAAGAACAGAAGCTAAGAGGAGAACTTAGAAAACAGAACATTCCATCAAGTAGCTTAGCAACGCCTGCAGCTGTGACGTCAGTTATAGACGACATGTGTAGAAAGCGAGACAGATCGCCATCACGCCACGCAGACAGTGTCTCTTACATCCGGGACCGAGGGGAGACTCGGGCATTCTGGGAAGGTAGCTCATTTAGCTCAAGTGGTGGATGA

Transcript

OS493_035507-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A6NHR9	Structural maintenance of chromosomes flexible hinge domain-containing protein 1 OS=Homo sapiens OX=9606 GN=SMCHD1 PE=1 SV=2
Q6P5D8	Structural maintenance of chromosomes flexible hinge domain-containing protein 1 OS=Mus musculus OX=10090 GN=Smchd1 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002050 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13589 all species →	HATPase_c_3	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR036890 all species →	Homologous_superfamily	Histidine kinase/HSP90-like ATPase superfamily	Interproscan
IPR038892 all species →	Family	Structural maintenance of chromosomes flexible hinge domain-containing protein 1	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22640 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006302 all species →	Biological Process	double-strand break repair	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K23113	SMCHD1; structural maintenance of chromosomes flexible hinge domain-containing protein 1	-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_035507-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

65.0Max TPM

13.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	14.70	24.07
polyp at pH7 6	18	18	13.56	23.12
coral polyp · control treatment	16	16	16.44	65.04
coral polyp · oil and dispersant treatment	16	16	14.43	64.67
coral polyp · oil treatment	16	16	12.37	20.87
coral polyp · dispersant treatment	16	16	11.20	25.04
Polyp	10	10	5.97	12.32

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	24.07
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	23.98
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.41
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	22.07
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	21.84
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.98
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.67
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.41
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.53
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.13
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.51
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.43
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.33
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.13
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.89
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.72
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.88
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.69
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	23.12
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.85
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.78
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.74
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.55
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.13
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.12
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.01
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.54
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.28
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.51
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.34
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.21
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.86
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.65
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.23
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.20
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.91
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	65.04
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.01
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	17.37
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.67
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.51
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.50
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.01
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.83
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.64
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.61
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.29
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.24
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.87
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.39
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.31
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.78
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	64.67
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.94
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.06
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.43
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.31
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.39
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.11
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.86
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.24
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.17
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.92
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.79
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.00
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.00
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.74
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.28
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.87
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.69
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.55
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.19
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.39
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.78
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.78
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.86
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.43
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.63
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.13
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.00
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.68
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.55
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.07
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.31
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.04
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.40
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.84
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.37
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.65
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.61
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.16
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.56
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.44
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.22
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.10
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.91
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.28
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.72
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.14
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.81
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	12.32
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	9.93
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.39
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	8.08
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	6.31
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.60
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	3.30
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	2.90
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.49
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.33

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.