Gene detail

Detailed information of OS493_035518-T1 in Lophelia pertusa

Genomic Location: scaffold_323:145108...149380
NR annotation: KAJ7351793.1, TPR and ankyrin repeat-containing protein 1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_035518-T1

ATGAAGACGATTCAAATCGTAACAATGAAGTCAACGATGCTGTTGCTTCCGTTACGTCAGAGACATGCATCGAGGGAGCTTTTGAGGGTTTGCCATGGGAAGTGGAATGCACCGCAGAAGTATGGAAAGTTTTTACATGGTAAACGTCTGGAATCATGGAAGAAAAAACTGTTTGTCGAGAAGGTGAGAAATCTTGCACAAGGTCGCGACAACTGGACCCTGCATCTCTGTAAAAGACTTGAAGGTTTGCCAAAGAGCCATGGCATACTTCTTTATGAAACAAGATTGACTGACGCTGCAAGAATCATTTGGGAATGTGCAGTTGCCTTCTCTCCCCGATATTCAGACGAAGACGCCGAAAGTAAGACCACGATCTACTCGGAAATCATCAGAATTTGGGACATTGTGTTTGATCACGACAATGTCCAGCACGCCATAGAAAACATAGTGAGGTCATTCACCCGTGGCCAGGGCTGTATCCTCAAAAAGGAACTAAGGGGGCTTCCCAGGGGAGAGGCTTCTCAAAACCAAGGTCCGAATCTCTATGTAAAGCGTGATTCTTCGTCTCCCACTGAGGTACAAGATAACAAAGCGCTTAAGCATGAAGCAAATGATAACCAAGTCACTTTCTTTCCTCCCGCAAGTCATCACGATAACGAGTATCAAGTGTTGAAGTTCTACCACCTGTCCACAGCCATGATTCAGACAATACTGAAACAGCAATCGTGCAAAGGCGAGGTCGACTTTCCATTTCGAGTGACAGAAGAGGAGCATGACATCATTAACTTTGAACCATCCCCCCAGAGCTCCATCATTTTGATTGGGCGGAGTGGCACTGGGAAGACGACATGCATCCTGTATCGCTTGTGGAAAAGTTTTATAAACTACTGGAGGAATGCTGTTGAGAGCGGGCCATTGATTTCCAAGAAGATGATGTTCCTTCCCAAAGAACAAAGTACCAGCCAGCTACAGAGTGATAGTGGTGTAACAAATGGCGATGATGGCGAGGCTGGTGCCAGTTGTTCAGTGGATCCATGTGTGTCTGTTGAAACAGGTTCTGAATCTGTAGAATCCCTTGAACATCTCCACCAACTGTTTGTAACCAAAAATGGTGTCCTCTGCCAAGAAATCCAGAAGAATTTTAATGCTTTGAGCCAAGCATGCCCATTCATCACACATGCGACTAAACAAGATGAAGTCCCTGTGAAGCTGCAGGATGTTGACGACTCTGCCACAGGCTGGCCACTTTTCTTAAATGCACGTGACCTTTACGTTATCTTAGATGCCTCTCTGCCTGAACCTTACTTCTTTCCCCGTAATGAAGATGGGAGCTTGGAGAGCAGGTTTCAAGACTGGGGCGAAGAAGACAACCAGTTGTCCACTATTCCTGTCATAGATGAAGACGACGATGAAGAAGATGACACAGATGAGGAGGATGAAGATCAGAACTCAGAGGGTGACGCGCCATCTTTAGAACAGAGCAGACCAATGATCCTAGTAAGCTACAGTATTTTTGAAAACCAGCTGTGGTCTAAAATGTGCAAGAAAAAGAAAGATGTCAACTTTCATCCGTCTTTGGTGTGGATGGAGATACGATCGTTTATTAAGGGCTCATACGAAGCACTGCATACAACGAGCGGTCATCTCAGCCTTGAAAGCTATCAGGAAATTGGACTAAAGAGGGCGTCCAACTTCACAGCTAACAGAGAAGCCATTTACAACCTGTTTATATCTTACGAGCGGGTCAAGAGATCTTCCAACATGTTTGACGAGAACGACCTCGTGTTTCATTTGTATCACCGATTGAGGCAATGCAGAGTTCCTGATTGGTCGATTCACAATCTGTACGTGGATGAAACACAGGACTTCACTCAGGCAGAGTTGATGTTGCTCATACGCTGTTGCCGTGATCCCAATGGCATCTTCCTCACTGGAGACACGGCACAAAGCGTCATGCGAGGGATCTCCTTCAGATTTGAAGATCTTCGCTCACTCTTCTTCTACGTACAGGAGAATTACAAGGCCGTAGGAGCACAAGCAGAAGTTGTAGTTCCAGAGGTAAAGCCACTCATCTACAACTACCGATCACACAGTGGAATTCTTAATTTGGCGTCCAGTGTTGTTGGCATACTGCAGAAATATTTTCCAGAGTCTTTTGACAAGTTGGAAAAAGATAAAGGTCAGCTGGATGGCCCTAAGCCGGTGATCCTTGAGTCCTGCAGTCAATTGGATCTTGCGATTATTCTTCGTGGAAATAAGCGGAAGACAACCACCATTGAGTTTGGTGCTCATCAAGCCATCCTTGTTGCATCGAACGAAGCCAGGGAAAGGCTTCCTGAGGAGCTTAGCCATGCTCTGGTGTTGACAATCTACGAAGCCAAAGGATTGGAGTTTGATGACGTCCTTGTATACAACTTTTTCAAGGATTCACAGGCTCGTATTGAATGGCGAATTGTTACTGAGTACCTCTTGAAAGTGGTGAACTGCGACAGAGTAAGCACGTCTGAAGTCAAGTCCCGTCCACTGATGTTCAATCCTGACAAGCACAAGATCCTAAACTCCGAGTTAAAACAGCTTTACACGGCTGTGACTCGAGCCAGAGCAAAGGTTTGGTTCTTTGACGAGGATGACGACAATCGTCGACCAGTGTTTGAATACTTTGAGCAGCTCGGCTTGGCAGATGTGGTAAAGCTAGAAGCAGGCACCGGGAACAGTTCTCCAAGTAGTCAGGCTTTGGAAAATATGTTCTCCAAGGAGTCGTCGTTAGAGGAATGGAATCAGCAAGGGAATTTCTTTTACAGCAAGAAGCTCTGGAAGGTTGCAGAAAGGTGCTTTACAATTTCTGGGAATGTAGAGATGAGCCAAAAGTGTAAAGCTTACGTCCAAGCCGACTATGCTCGAAGCCTTCACAGTGAGCCACGGCGACTGAAGACTGAATTTCTACGAGCAGCCGATCAGTTTCTGCAGTGCAACATGATTCAAGAAACTAGGGTTTGCCTGTATAATGCACGGGAGCGTGCCCTCTACGCAAGCCTTCTTCAGAAGCTTGGGGAGGACAAGACTGCAGCAAGGTGGTTCGAAAGAGGTGGTAGCTTTTTAGAAGCAAGTCAATGCCTGGAGAATCTTGGAGACTACAAAGAAGCTGTTGAAGTCCTTGTTCGTGGAAATCTTTACCACAAGGCCATCGATGTTCTCAAGCGGTTCAACAACAAACTGTTTCCAGATAATCAGAGGAAGAACCTTGCACCAAGGAGAACTCTTCAAGAATTGTGCTTAGCCTCTGCAGAGCTCCATTTCAAGGGAGGAATTTGA

Transcript

OS493_035518-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O15050	TPR and ankyrin repeat-containing protein 1 OS=Homo sapiens OX=9606 GN=TRANK1 PE=1 SV=4
Q8BV79	TPR and ankyrin repeat-containing protein 1 OS=Mus musculus OX=10090 GN=Trank1 PE=2 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000890 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00580 all species →	UvrD-helicase	UvrD/REP helicase N-terminal domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR039904 all species →	Family	TPR and ankyrin repeat-containing protein 1	Interproscan
IPR011990 all species →	Homologous_superfamily	Tetratricopeptide-like helical domain superfamily	Interproscan
IPR014016 all species →	Domain	UvrD-like helicase, ATP-binding domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR21529 all species →	MAMMARY TURMOR VIRUS RECEPTOR HOMOLOG 1, 2 MTVR1, 2	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_035518-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_035518-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

24.5Max TPM

6.6Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.35	13.55
polyp at pH7 6	18	18	7.88	13.63
coral polyp · control treatment	16	16	8.50	24.52
coral polyp · oil and dispersant treatment	16	16	6.74	15.13
coral polyp · oil treatment	16	16	5.60	13.59
coral polyp · dispersant treatment	16	16	5.22	11.04
Polyp	10	10	2.01	5.27

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.55
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.76
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.86
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.44
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.88
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.83
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.13
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.78
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.68
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.59
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.38
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.25
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.22
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.92
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.44
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.85
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.57
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.19
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.63
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.48
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.20
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.20
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.49
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.52
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.99
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.77
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.55
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.22
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.12
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.35
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.18
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.77
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.45
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.24
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.98
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.64
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.52
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.61
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.35
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.76
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.23
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.44
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.63
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.40
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.02
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.90
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.66
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.86
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.33
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.07
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.39
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.80
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.13
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.96
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.39
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.04
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.99
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.59
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.58
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.55
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.35
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.46
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.07
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.46
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.31
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.16
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.37
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.42
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.59
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.68
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.50
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.15
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.71
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.38
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.25
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.53
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.51
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.79
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.35
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.30
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.87
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.40
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.32
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.30
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.04
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.19
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.11
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.29
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.26
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.87
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.04
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.31
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.27
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.00
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.78
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.03
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.01
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.99
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.26
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.06
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	5.27
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.23
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.98
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.59
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.90
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.45
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.01
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.77
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	0.63
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.31

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.