Gene detail

Detailed information of OS493_035612-T1 in Lophelia pertusa

Genomic Location: scaffold_326:191385...205251
NR annotation: KAJ7382335.1, WD repeat-containing protein 49 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_035612-T1

ATGACAAGTAAACTTATGCAGCTGATCGAAACAAGGACCAAACGACCGGTTTTTGATGAATCGGAGTTGAAAGTTAGCTCTCACTGGAAACTTATCAAGTCCGCCATCAAGCAAAAACATGGCGACGACCCGAAGAAACTTGATGAAAAACAGGCTCTAAATGTGGGACACGGCGTTCATCCGGTAAATTATTTGGAGTCTGAGGAAGACATTAGCTTTTTAGCTTTCAACTCATTTAACGATAACTTCGTTGCGATTGACAGCGAGGGAAAAGTGTCGGTGTTTTTAACAACCGGTTACAGAGAAGATGTTGACAGCAAGACCCTGAAGGATCCCATCTGTGGAATATTGTATGCAAAGAAAACAAGATTTTATGTTGCTTGGGGATTTGATGAAAATATAAGATTAATGTCAGATGGCTTCAAAGTGATAAGTGTGGCAACTTCTGTCAGCAGAATATTCAGTGGAGTGTATAATGAATCCACAAATGAGATCATAACTGGGGGAGTTGGAAATATCACATGTTGGAGCTTTAGATATGGAGCAAAGTTTTTACTTCAGCGTAAAGTACTGTCGGAGTGCATGCCATCATCCAGTACCATTTCATTGCTGTGTTTGGAAGACACACCCAGCAGATCTCAGAGGTGCTTTGCTGTGTATCATAATAATGTGATTATATATAACCTGCTTAATGGCTCATGTGTTGGACATCTCAAAGAGCTGCATCCCAGAGAGATTACTGCTGTGTTGTTCTTCAATCCACTCAAGTATCTTATAACAGGCGCAAAAGATGGCTCCATAAAAGTCTGGGATGACAAAGGCAACATCAAGATCATCTTTGTTGGCCATTTAAAGTCAGTGAACACGTTAGTCGTGTACCCGTTCGGTACTTATATCATGTCTGGCTCCAGTGACTGCACTATCAGAGTCTGGAGTTTAGATACTGCTGACGAAGTTGACAGAATAGACACTAAAGATGCTGTTCTGGGGCTTGGGACAATTGTTGGAAAGAATGACTTGTATTCATTTGGAAGTAGATCGATTGAGTTGTGGAGAATCGAGCACATTCATAGTGTCTTTGCAACTGTAGGAAGTAAAATCAAATCTATCAAGCCTACAACGCATCCTAGAATGCCGTTAAGACTGGTGTGTACATGTAGTGATGCAACCGTACGCCTGTTGTCCCCAGGCTCCGGCGAGTGTATCGCCACAATGCTGTTACCCAGCATGAGTATAATCGCTGACGTGGCGTATGCGGCTGCTGAAAGTTTGCTGTTTACTTTGCTCTCAAATGGTAAAATCTTAAAGGCATCCACCATGACTAATCCTTGTAAAAAACTTCAAGAGTGGGACACGAAGACCAACCCAGATGCACCAAGTCAGTGTACCTGTCTTTGTCTTTATGAATACGTAGTTGAGGATGAGCTTGATGGCGATTCGTGGGGGAATTTGGTCACCGCCCTGAAATCCAAGAAAAGAACGGAGGAACTTGAAAACCAAGGACAAACTATCAACTCATATGACAGAACTCTGCTGCTCGGCGGCTGTGTAAACGGCATGATTGTGTTGTTTGACTGGCAGAATGACACGATGCCCGGCAAAGTCTCCTTTCAAATAGAGGCGCACAGAGATGAAGTGATTACCATGGTAGCTAATCCAGTTGTTGATCAAGTCATATCCGCTGGGCTGGACCACGTGATCAAGATTTGGCGCCTTTTTCCATTCGCTGAGGAAGCCCTGGCCCCTCTGATGACGTTGTACTGCCATGAGACCCCCAGGCTCCTGTCCGTGGCTCACCACAAGCTGTGTGCGGCATTCCACGAGCCAGCTACAGCTTCATATAACATTGTGGTGTTCAAAACCACTCAAAAAAAGCGGTTTGACCATAGCAGTGATTCTGATCACATGGATGACGTCACAGGATTGGCCAGCTGTTCCAAAATGAGGCTGTTTGCGTCATGCAGTGCTGACGGCTCCGTGAGGATCTGGGACGAGGCCAACAGACTGGTGCGTGTCATCAAATTGAACGCCACTCCAACCAGCATCTGTTTCTGTAGTCAGAAAGGCGACCTGATAGTGGGCATTGGTAAACATCTACACAAAATAAATTACGCTACATACATGCCACAGTCGTATATTTTCCGAATGGTGGCGATGGATTTCCGACGGGTAGTTTCCGAAGCACCGATGGATATCGACTCGGACATGAAGGGCGGTCTAACACCCGAAGAGTGTCAGCGCCTGGCCCGAGTCAAGTCGTCCCTGCACAAGTACAGTAGGTTTAAAGACGCATTGCCACAGGATGAGATGGACGAGAAGATTCAGGAAGAGGAGAGAAGAAGCCAGGCTTTCGCAAAAATTCAGGAGCGCGAAAAAGAGCTCAGAAAACTTCGCGACGGAACTTACGAATTTAACAGGAAACGACAAAACATCGACACAGAGACAGTGCGTGGAGAAGCGTTTGAAAAATACTTGGAAATTTTTTACAAGCGGCCGTGTATCGATCTTCCAGACGATGACAACATGGAGGAGGACGAAGGGTTTGGTTACGAAGAAGAAGACGAAGAACCATACGCAGCTGATAGAGGGAACGGTTTTTTCTCGATAAGTAGACAATCAACTCGATCAAAGAAAAGCCACTCATCGCCTGAAAAAGCTCCAAAACCCGAGATTTCGAGCTTGTCCATGTCGGAGTTTGAACCCGTGAAATTACAAGACGACAGAAGCGAGTCACCGGCTCTTCCTCCTACTAAAGAACTCGATGAAATGTCGCGATCTGGACGCCCCTTCACCATGGAGACAGAAAGCGACATCTTCTCGCACGAGGAAACAAGTTCCAGGGTCTCTCACTCAGCGCCCATGCACAGACGGGATTTCCGAAGTCATCCGATAGAACCACCGCTCGTGAATCGGGACCGCGATCGATACGTTGTCGACGTGCCGAAGTCTCATCGGTATCCTTCGCCGAGCCAGTCCGTTCAACTGGTATCGCAGAGGCTTTCGCGTCTGGCTTCACATCAAGCTCATCAAGCTGAGGTTGACGGCGATGAAGAGATGTTCGTTATCGCTCCGGATGGCTTTATTCCGAACTCTGTCGTTGTGGCCATGTTTAAAGATTTTAGAGAAGAGGGCAAGGAGGAGGCAGACACGTGGAAACCGCCACAGTTAACTGCAGAACAACTGGCTGAGCTGGAGAGTAGGAAGAAGAAACTACCAAAATCTCCTGAACGCGAGAGTCCAAAAGGAAAGAAGGCGAAGTCGAAGTCGAAATTTGCTGATCAACTGCAACTTGCTTTACGAGACCTTCCCTCACCTGAACCTATCGACGATAACGAGCTCTTGAAATCCCCTACCCCCACGACCACCCCCGTCCCCTCCCCCTGCAGAGGAAGCGTCACCTACCAGGATCCCCTCCGCAAAGAAAGAAATCAAACCAGTTCGACCGATTGA

Transcript

OS493_035612-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
A6NE52	WD repeat-containing protein 97 OS=Homo sapiens OX=9606 GN=WDR97 PE=1 SV=2
P58405	Striatin-3 OS=Rattus norvegicus OX=10116 GN=Strn3 PE=1 SV=2
Q9ERG2	Striatin-3 OS=Mus musculus OX=10090 GN=Strn3 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003046 (this species only)
Ubiquitin family	UBD\|Other\|Beta-prp · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|CDC20 · all ubiquitin genes in this species
Ubiquitin family	E3\|E3 adaptor Cullin RING\|DWD · all ubiquitin genes in this species

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00400 all species →	WD40	WD domain, G-beta repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001680 all species →	Repeat	WD40 repeat	Interproscan
IPR036322 all species →	Homologous_superfamily	WD40-repeat-containing domain superfamily	Interproscan
IPR015943 all species →	Homologous_superfamily	WD40/YVTN repeat-like-containing domain superfamily	Interproscan
IPR020472 all species →	Repeat	G-protein beta WD-40 repeat	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45532 all species →	WD REPEAT-CONTAINING PROTEIN 97	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_035612-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_035612-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

21.7Max TPM

3.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	2.34	4.48
polyp at pH7 6	18	18	1.92	3.04
coral polyp · control treatment	16	16	5.23	21.70
coral polyp · oil and dispersant treatment	16	16	4.49	21.52
coral polyp · oil treatment	16	16	3.52	6.37
coral polyp · dispersant treatment	16	16	4.36	7.17
Polyp	10	9	1.10	2.65

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.48
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.47
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.21
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.77
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.75
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.62
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.54
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.32
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.02
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.88
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.80
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.75
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.51
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.50
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.48
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.42
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.34
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.26
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.04
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.93
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.55
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.34
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.28
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.01
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.00
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.91
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.90
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.86
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.83
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.81
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.70
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.62
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.41
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.22
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.13
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.08
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.70
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.54
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.84
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.42
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.39
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.23
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.85
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.72
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.69
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.58
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.06
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.95
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.80
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.50
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.47
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.90
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.52
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.32
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.02
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.80
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.18
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.68
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.58
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.38
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.26
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.21
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.19
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.68
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.60
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.49
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.12
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.83
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.37
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.11
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.21
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.18
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.06
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.05
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.82
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.47
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.41
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.32
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.19
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.97
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.31
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.15
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.83
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.90
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.17
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.43
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.95
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.80
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.69
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.63
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.81
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.70
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.46
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.32
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.92
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.84
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.74
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.14
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.96
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.20
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.65
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	1.85
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.47
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.37
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.04
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.95
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.83
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.46
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.37
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.