Gene detail

Detailed information of OS493_035815-T1 in Lophelia pertusa

Genomic Location: scaffold_336:52028...77756
NR annotation: KAJ7319505.1, hypothetical protein OS493_035815 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_035815-T1

ATGGTAGTTCAACAGTTATTGGACGAGCCTCCCCTTGTGCAAGCTTGCTTTCACGGTGATGCAGTCGAGGTGCGGACGCTGATAAGCAGGAAAGAGGATGTCAATCGCCAGGACGAGGAGAAGAGAACTGCATTGCACGCAGCTGCACATTGTGGGGAGAGTGAATGCATCAGTGTTCTCATTGCTAATGGAGCCCGCGTCAATACAAAAGACAATAAATGGATGACTCCTCTCCACAGGGCATGTGCTTCAGGAAGTGTGCAGATGTTAATGCAAGAGACAAGAAACTGGCAAACACCTCTGCATGTCGCAGCAGGCAATAATCACATGAGATGCGCAGATGTTCTTATTCCTCATCTGGCAAATGTGAATGTGACCGACAGAGCAGGAAGGACAAGCTTACACCATGCGGCATTCAATGGTCATGTTGAGATGGCACAACTACTTTTAACCAAAGGAGCCCATGTAAATGCTATGGACAAAAAAGACAGGAAGCCAATCCACTGGGCTGCATATATGGGTCGCATTGAGTGCTTAGAAGTTTTATTTAAATCAGGAGCAGAGATCAACTGCAAAGACAAGAAGCAATACTCTCCTCTTCATGCCGCGGCTGCTGGAGGACAACTGACCACACTTAAGCAGCTGTTGGGGCGTGGAGCATCGGTGGATGCTAAGAACTTAGTCGGTAACACACCCCTTCATATAGCATGTCTCAATGGGCAGGACATAATTATCAGTGAACTGATGAACTATGGTGCTTCTGTTAATGCCTCTAACAAGAAAGGCATGACTCCATTACATTATGCTGCAGTGTCAGGTCAAGGTGATGTGTGTCTTGAACTGTTGTTGAATGACGGTGCTAGCCCTAACTTGCAGTGCAAGAGTGGGAGGACGCCACTTCATTATGCTGCCCTGTATGGACGCTGCTCAAGGGCTCAAACTCTTCTGCAAAATGGTTGTTATGTGGACGCAGCAGATATAAGAGGGAATACCCCTTTACACATAACAGCATTGCATGGTCAGGAGTTATTACTAAGTGTACTGCTGGCCAGTGGAGCAAACCATGCGAGGCGTGGTTCATTTGGAATGTTACCTCTTCATATGGCAAGCTTAGGGGGCTTCACAGACTGCTGTAGAAAACTGATAGCATATGGTAATGATGTCAATGCAAAAGATGATAATGACCATACCTGTGTTCATGCTGCTGCCTGCAGTGGAAATGTAGAATGCTTGGGACTTTTGTTGCATAGTGGTACTGATTATAATGCTGTTGACAGATTAGGAAGAACTGCACTTCACTATGCCGCTGGTCATGTGCACTACTGGTGCGTGAAATCATTAGTCGCATCAGGCTGCAATGTAAATAAAGTGGACACAAGAGGCTGCACTCCTCTACACTATGCAGCTGCCGCAGATCCTGATGCCAAATGCGTGGAACACTTATTAAGAAATCGAGCCAATGCAAGTAAAAGAGATAAACAAGGATACAGTCCTGTACACTATGCTGCCTCCAGAGGGCATAAACTGGCTCTAGAAATGTTATTAGATGTTGCTGCAACAGATCTTTTAAATAAGAGTTCAGGCTCCCCTGCTATCACTCCTCTTCATTTAGTGGCTTATCATGGTCATTTTCAAGCTCTTCAAGTGCTTTTAGAGTCTTTTATGGACATTGATATTAAGGACGCTAATGGTCATACTCCTCTTTATCTCGCTTCTTTTCAAGGACATGTTGAATGCGTAGAATGTCTCTTAGAACACAATTCCAAAGTTTTAGTATATGACAACATAACCAAGAGAACGCCTCTTCATGCCGCAGCTTATAATGGACACACTGATTGCTTAAGACTTCTTCTACAATACAGTAACACAGAAAGTGCTTTGGACTGTACTGATGCAGATGCAAGGACACCTTTAATGGACGCAGTTGGTAATGGTTTTGTGGACTGTGCCAATCTTTTACTCGCCGAAGGAGCAAATCTTTTATCTTTGGATGTTTATCACCGCAGTGCGCTTCACAGAGCTGCGGCAAATGGTCATGATGAATGTGCCGAGTCTCTTTTACACAGAGAAGCGGATGCTCTTTGTAGAGATTGCAATGGCCGCACTCCCCTTCACTTCGCAGCAGCTTGTGGTCATGTGGGCATTTTAAATGGCCTTCTTCAAGTTGTAGGTAGTGGTGTTCACATGGATAATCACGGCTACACACCGCTTCACTGGGCTTGCTTTAATGGTCATGATACGTGTGTGGATATATTACTAGAGGGTGACAACTCGAGAGTTTTTGATGGGAATCAATTTACGCCTCTACACTGTGCAGTTATAAATGATTACGAGTCGTGTGCAGAAATGTTACTAGACACGCTGGGTGATGAGATAGTTAACTTATGTGACAAGAAAGACAGAACGCCCGTCCATGCCGCAGCTTTTAATGATCAAGTAGAATGTCTTCAACTTCTCTTGTCAAGAGGAGGGAATGTGGATTCAATGGATCAATCTGGGAGAACACCTCTAATAATGGCCGCTGACAATGGTCATGCAGGCGCAGTAGAATACCTTGTAGGAGATGGTGGAGCTGACGTAAATATAGCTGATCAAAATAAAAACGCCGCATTGCACGTGTCTAGCCGTCAGGGTCACACTGCCTGCGCTCTTTTAATTCTGGACAAAATGGAGGACTCCGCTCTAAGCGAGTCAAACACCGCTCTCCAAACGCCCTTACACTTATCCGCTAGAAATGGCATGGTACCAGTTGTACAAGAGCTCATAGCAAGAGGGGCCAATTTACTGGCCGAGGACGAGGATGGACATAATCCTGCTCTCGCTTGTGCACCCAACCCACAAGTAGCCGACTGTCTGGCACTCATCCTGGTTGCCATGGTACCCAGCTTGGGGTCTCCCATGGCAACCTCCGAGCGCCTGGAAGGAACAGAGGATCATATAGAAGAAGAGGACACGTTAGATTATCCCAAGCCCACACACAATGCTACGGTGTAA

Transcript

OS493_035815-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q5ZLC8	Serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit C OS=Gallus gallus OX=9031 GN=ANKRD52 PE=2 SV=1
Q8NB46	Serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit C OS=Homo sapiens OX=9606 GN=ANKRD52 PE=1 SV=3
Q8BTI7	Serine/threonine-protein phosphatase 6 regulatory ankyrin repeat subunit C OS=Mus musculus OX=10090 GN=Ankrd52 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004211 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13637 all species →	Ank_4	Ankyrin repeats (many copies)	Repeat	Interproscan
PF12796 all species →	Ank_2	Ankyrin repeats (3 copies)	Repeat	Interproscan
PF00023 all species →	Ank	Ankyrin repeat	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR002110 all species →	Repeat	Ankyrin repeat	Interproscan
IPR036770 all species →	Homologous_superfamily	Ankyrin repeat-containing domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR24198 all species →	ANKYRIN REPEAT AND PROTEIN KINASE DOMAIN-CONTAINING PROTEIN	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_035815-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_035815-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

45.9Max TPM

13.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.46	17.65
polyp at pH7 6	18	18	10.48	15.22
coral polyp · control treatment	16	16	18.15	45.87
coral polyp · oil and dispersant treatment	16	16	12.44	29.62
coral polyp · oil treatment	16	16	15.87	21.46
coral polyp · dispersant treatment	16	16	12.35	25.88
Polyp	10	10	10.31	16.63

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.65
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	17.33
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.48
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.19
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.66
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.26
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.73
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.48
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.42
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.41
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.21
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.07
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.62
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.43
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.68
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.28
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.97
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.50
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.22
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	15.03
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.58
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.36
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.71
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.63
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.11
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.96
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.39
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.54
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.44
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.01
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.86
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.45
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.23
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.16
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.50
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.43
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	45.87
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.48
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	24.71
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.62
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.78
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.09
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.06
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.84
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.95
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.54
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.37
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.12
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.75
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.62
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.39
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.18
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.62
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.86
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.31
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.39
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.83
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.42
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.91
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.87
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.41
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.30
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.26
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.05
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.92
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.24
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.39
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.30
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.46
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.53
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.53
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.51
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.41
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.36
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.22
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.69
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.09
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.92
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.91
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.80
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.53
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.28
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.16
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.47
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	25.88
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.72
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.76
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.48
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.44
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.48
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.19
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	12.48
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.77
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.59
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.03
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.97
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.94
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.10
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.64
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.09
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	16.63
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	13.40
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	13.38
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	12.70
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	10.63
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	9.79
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	9.17
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	7.80
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	6.30
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.34

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.