Gene detail

Detailed information of OS493_035885-T1 in Lophelia pertusa

Genomic Location: scaffold_338:135318...166772
NR annotation: KAJ7382304.1, hypothetical protein OS493_035885 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_035885-T1

ATGTCTTCTTCGAGCGGCCTGACGGAGGAAGATTTACAGCGAGAAGCCCGCATTTGCCAGAAGTTACGGCATCCTCATATTGTTGAAATTGTAGGAGCTTACTCAATGGATGGCTTTATTTACATGGTGTTTGAGTATATGGATGGTGCTGATTTGTGTTTTGAAATAGTGAACCGTGTTCATGCTGGTTTTGTTTACAGTGAAGCTGTAGCAAGTCACTACCTCAGACAAGTTCTGGAAGCTGTGTCTTTCTGTCATGAAAATGGAATTGTTCATCGTGACCTCAAGCCTCACAACATTTTATTATCAAGTAAAGAGAATTCAGCTCCAATCAAGATTGCTGACTTTGGTGTCGCTGTAGAAATTGGGGAAGAAGACTATGTCACAAGTGGTCGCATAGGAACCCCACACTTCATGTCTCCGGAGGTGATAAACAGAGAACAGTATGGAAAACCTGTGGATGTGTGGGGAAGTGGCATCATACTCTTTATTCTTGTCAGTGGATCGTTCCCCTTCCATGGCACAGGAGAAAAAATATACGAGTCCATCAGGAAAGGAATTCCCACGATGCGAGCCAAACTTTGGGACAACATATCAGATGAGGCAAAAGATCTGGTGAAGAAGATGTTGGCACAAGATCAGAATGAGAGACTGACAGCGAAAGAAGCACTGCAACATCCATGGCTAAGTAATCGCAATGTTCCTCAGAGAATGCATCTTCAAGATTCAGTCGATGAAATGAAGAAGTTTAATGCAAGGAGAAAATTAAAGGGAGCCATCTTAGCTGCAGTCGCCAGCAGAAAATTTCCAATGGCAAATGGAGATGTTATTGGGTCTCAGGACGATGTCTTTGAGTTCGAGGATGATGATCTGTCGGCATCAGGGGCTATAGGTCAGCTTCTCGACTCACTAGAAGAGATCCAAGTTCTCACTGGAGCAAACGACGATGATGTGAACTTTTTACAAAACTTTTTTGAACATCAAACGCTACAAGCGTTACTAGAGGTTTATGATAGAAGCCAAGAATGGACGGACGAGAACCGAACATGTCCCTCGCCGTCGGCTCCGAGCGCCGTACAGGACGCAAAAGAGGTTGTTGACCTGGTCGAGTTCAGGGCAGAAGACGACGACGATTGCTACGAGTTGCAAAATATCTTATCGGACCCTCATGTTATGGCGCTGCTGCAGTCACACGATGAAGTGTTGAAGAACAACACGTCTGGCGAAGAAGTGAACCCATATCAGCCCGATACCACCACGGGGACTGGGTATAGCAGCAGGATGGACGACTCTGTAGTTGATCGACCAGAAAAACTAACGCGTGTCCGACTTGTTCAGTTCCACAAAAATCCCAACGAGCCTATGGGTATCACTCTGAAGCTAAACTTGGAAGGAAGATGCATTGTAGCGAGAATTATGCATGGTGGAATGATTCACAGACAAGGCACGCTTCATCCTGGGGACGAAATTCGGGAAATAAATGGCGTCAACGTGGCGGAAAAATCAGTTGAAAATCTTCAAGCTATTCTGCGTGACGCGAGTGGAAATGTGACGTTTAAGATTGTACCGAGCTCAAGAAATATCAACCAAGTGTCCGAGGTGTACGTGCGGGCGCTGTTTGATTACGACCCCCGAGGAGATGACCTTATTCCATGCCAACAAGCTGGACTGTCATTCACTTGTGGCGATATTATCCAAGTCGTGAGCAAAGCTGACCCGCGAGTCTCGTGTTTAGCTGCGGAAAAAGCCAGGAAGCAAAATGGTGCAACTTGCATCTGGTTCAACAAGAAAAAGAAAAGCGGCCGTGATAAGTACGTGGCGAAGCATAATGCAGTATTCGATCAGCTTGATCTTGTTACTTATGAAGAAGTGGTCAAGCTGGATTACTTTAAACGAAAGACGCTTGTTCTTCTTGGGGCCCATGGTGTTGGGAGAAGACATATAAAAAACACGCTCATCAATAAATATCCCGAAAGATTTTCATATCCTATTCCTCATACGACACGAGAACCCAAGGATGGAGAAGAGGACGGCAAAAATTACTTCTTCGTCTCCGCCGAGGACATGTTATTGGACATAGAAGCCAATAAGTATCTGGAGTATGGCACGCACCAGGGGGCCATGTATGGCACGAAACTCGACACGATTAGGGACAATCTCAACCAGGGCCTTACAGCTATACTCGACGTGGAACCTCAGGCGCTGAAGGTTCTTCGGACGACTGAATTCTCGCCTTATGTTGTGTTCATCTCCGCACCAACTATCATTGGAAACGACAGCATGAAAAGTCCGTCCACACCAAATGGAGATGTTGCTGACGAAAGTCTTCAGCGGTTGGCCAAAGACTCGGACTCACTCCGCCAGACATACGGACACTTGTTCGACCTGACAATCGTCAACAACGATATCGACGACACTATTAGCCTGCTGGAGAACTCTATCGAACAACTCCACAAAACCCCACAGTGGGTACCCGTGTCATGGGTGTACTAA

Transcript

OS493_035885-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
O14936	Peripheral plasma membrane protein CASK OS=Homo sapiens OX=9606 GN=CASK PE=1 SV=3
O70589	Peripheral plasma membrane protein CASK OS=Mus musculus OX=10090 GN=Cask PE=1 SV=2
Q62915	Peripheral plasma membrane protein CASK OS=Rattus norvegicus OX=10116 GN=Cask PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000787 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02828 all species →	L27	L27 domain	Domain	Interproscan
PF00625 all species →	Guanylate_kin	Guanylate kinase	Domain	Interproscan
PF00595 all species →	PDZ	PDZ domain	Domain	Interproscan
PF00069 all species →	Pkinase	Protein kinase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR014775 all species →	Domain	L27 domain, C-terminal	Interproscan
IPR008145 all species →	Domain	Guanylate kinase/L-type calcium channel beta subunit	Interproscan
IPR036034 all species →	Homologous_superfamily	PDZ superfamily	Interproscan
IPR001478 all species →	Domain	PDZ domain	Interproscan
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR036892 all species →	Homologous_superfamily	L27 domain superfamily	Interproscan
IPR008144 all species →	Domain	Guanylate kinase-like domain	Interproscan
IPR050716 all species →	Family	Membrane-associated guanylate kinase	Interproscan
IPR036028 all species →	Homologous_superfamily	SH3-like domain superfamily	Interproscan
IPR020590 all species →	Conserved_site	Guanylate kinase, conserved site	Interproscan
IPR004172 all species →	Domain	L27 domain	Interproscan
IPR008271 all species →	Active_site	Serine/threonine-protein kinase, active site	Interproscan
IPR000719 all species →	Domain	Protein kinase domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR23122 all species →	MEMBRANE-ASSOCIATED GUANYLATE KINASE MAGUK	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005102 all species →	Molecular Function	signaling receptor binding	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0005911 all species →	Cellular Component	cell-cell junction	Interproscan
GO:0034613 all species →	Biological Process	protein localization	Interproscan
GO:0046928 all species →	Biological Process	regulation of neurotransmitter secretion	Interproscan
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K06103	CASK; calcium/calmodulin-dependent serine protein kinase	EC:2.7.11.1	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_035885-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

36.5Max TPM

18.1Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	16.49	30.67
polyp at pH7 6	18	18	16.25	22.73
coral polyp · control treatment	16	16	23.79	36.46
coral polyp · oil and dispersant treatment	16	16	21.24	31.86
coral polyp · oil treatment	16	16	18.55	30.42
coral polyp · dispersant treatment	16	16	19.98	35.91
Polyp	10	10	6.98	13.12

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	30.67
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.76
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.29
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.24
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	19.91
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.61
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	18.35
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.62
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	16.39
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.65
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.24
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.08
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.90
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.88
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.43
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.03
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.58
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.15
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.73
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.62
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.41
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.12
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	22.10
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	21.73
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	19.37
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.67
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.27
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.38
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.86
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.70
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	14.40
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.59
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.28
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.97
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.66
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.57
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	36.46
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.87
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.80
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	31.04
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.95
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.25
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	28.37
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	27.15
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.72
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	22.13
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.48
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.14
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.49
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.51
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.90
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.34
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.86
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.07
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.53
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	27.18
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	26.74
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.38
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.64
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.30
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.25
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.15
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.82
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.97
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.96
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.95
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.81
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.29
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	30.42
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	28.95
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	24.38
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.92
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	23.18
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	21.38
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.39
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.81
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.66
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	18.13
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	17.71
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.41
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.91
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.08
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.93
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.60
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.91
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	31.71
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.64
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.28
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.59
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.09
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.80
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.61
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.93
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.82
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.78
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	17.81
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	14.13
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.83
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.92
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.90
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	13.12
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	12.06
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	11.75
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	9.54
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	6.42
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	4.78
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	4.06
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	3.05
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.59
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.40

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.