Gene detail

Detailed information of OS493_036007-T1 in Lophelia pertusa

Genomic Location: scaffold_343:264210...281253
NR annotation: KAJ7388729.1, Serine/threonine-protein kinase 36 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_036007-T1

ATGGAACGTTATCATGTTTTAGAGGTGATTGGAGAGGGTTCTTTTGGAAAAGTCTACAAAGGAAGGAAGAAATTTAGCGGCCAGGTTGTGGCATTAAAATTCATTCCTAAAGTTGGTAGATCTGAAAAAGAGCTGAAAAATTTACAGAGAGAAATTGACATCATGAGGAACCTAGAACATGAAAACATCATCAAATTACTGGACTCCTTTGAGACACCCAAAGAGGTATGTGTTGTAACAGAGTATGCTGAAGGAGAATTATTCCAGATCTTGGAAGATGATGGTTCTCTTCCAGAACAACAGGTCCGAATGATTGCCTGCCAACTTGTCAAGGCTTTGTACTACCTCCACTCTCACAGGATTCTTCACAGAGACATGAAACCACAAAACATTCTCCTCGGAAAGGGAGGAGTTGTCAAACTGTGTGATTTTGGATTTGCAAGAGCAATGAGTATCAACACCCTTGTATTGACATCAATAAAGGGAACTCCATTATATATGTCTCCAGAATTGGTGCAGGAGAAGCCTTATGATCACAACTCTGATCTCTGGTCTGTGGGGTGTATTTTATACGAACTGTATGTTGGAACACCACCATTCTATACCAACAGCATCTTTCAGTTGGTGAACTTAATTTGCCGGGATACTGTCAAGTGGCCTGAGAACATGAGCCCTGATTTTCAGAGTTTTCTTCAAGGCCTCCTTACTAAAGATCCCAACAAAAGACTGTCCTGGCCTTATTTACTCAGACATCCGTTTGTGGCGGATGGAATAAATGAAGCTGAATTGGAAAGGATCAGTGATCCGGAGATGTTTGAAAAACCTTCAAATGTAGCAAGCACTGTGGGGAAAACGACAAAAACCAAGGGAAAATTCAAGAGCGATCAAAAAACAAGGGTGGTACTGCCGAGAAAGGAAAGAGTTGATGAGGAAAAAGTTGTTGATGATGACTGGGAGGTGCAGTTAGAAGATAAGCCAGTCACGACAGACCGGTTAGGACATGAGATCAGTGATGACTATGAGAGAGAGACATCAGTTATTGAACAAGTCTTGGCTGCCGCAGGGAAGAGACGAGAAGAAAAGAGTAAGAGGCAGGGAGGAAGTCATTATGGAGGACAGGAGGAGCTTGATAGCGAAGAGGAATGGGACTATCTTGTGGAGCTGACAGAACAAGCTGCCACAGGCAGACCATCCCAAACAGACACACCAGTAGAAGATGTTAGAATTACTGAGAAACTTATGACTGACTCAGCATTTATCAGTAAAGTGCAGAGCGCACTAGAAACTGTAGCAGTTCAAGTCTTGGATGGCTTGCTTGAGGGAGCATCTCGTTTGAGACAAGTTCTTCGAGTTCTCAGAGGTTTACTGATAACTACTTGCTCGCCTGAAGTGAAACGATACTTTTCAAGTTCAGTTGGAATTCCTGTGGATAATGTCATTTTAATAATACAGTTGATCAAAAAGCCAGGTCTTTCTCAGCAACCGTGGGTAGTACAAGTTCTTGTGGATCTGCTGAATGTGACGACTGCTTTCCTTGACACCTTTATTCTTTTGAACAGTGACACCACCAGAGAAAGTTCTGTTCTGTTGAGCTGTGGGAAGAAGCTTGTGGGAGTTCTACCAGCACTGATGCAACATGGTCAGGACAAAGAACTGAATCTTAGACAGGCTACTCTGGAGTGTGTTCAGCGCATGTGTAATGCCATAGACAGACATGATGCTGCGGTATCTGAGGAGTTTTATGATAATCTTGTGACCTGTGACATAAAGAGTGTGGATTGCCTCATCACAGCTCTTCTTGTGGAACCAAATGCCATACAAAGACTCAAAGGTGCAATTGGAGATTCTACATCTGTAAAAGCAAGAGTGATGCGCCTGCAAGTTGTTGCTATAACAACAGTGACATCATTAGTGACCTCAGTGAATAGTCCAAATAAGGAATCGAGTCCGAAAAGGAACTTAGCCAGCCTTGTAGCAAAGAAACTTCTTCAGCCGTTGAATGAAAACTGTTTGGATGTATTACATCAGTTTCTTCACCATAAAACATCGTCTCTCTGCTATTGGTTTGCTTGCTGA

Transcript

OS493_036007-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q69ZM6	Serine/threonine-protein kinase 36 OS=Mus musculus OX=10090 GN=Stk36 PE=1 SV=3
Q9NRP7	Serine/threonine-protein kinase 36 OS=Homo sapiens OX=9606 GN=STK36 PE=1 SV=2
Q5RAJ5	Serine/threonine-protein kinase 36 OS=Pongo abelii OX=9601 GN=STK36 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004122 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF00069 all species →	Pkinase	Protein kinase domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR000719 all species →	Domain	Protein kinase domain	Interproscan
IPR011009 all species →	Homologous_superfamily	Protein kinase-like domain superfamily	Interproscan
IPR017441 all species →	Binding_site	Protein kinase, ATP binding site	Interproscan
IPR008271 all species →	Active_site	Serine/threonine-protein kinase, active site	Interproscan
IPR021133 all species →	Repeat	HEAT, type 2	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR22983 all species →	PROTEIN KINASE RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0004672 all species →	Molecular Function	protein kinase activity	Interproscan
GO:0005524 all species →	Molecular Function	ATP binding	Interproscan
GO:0006468 all species →	Biological Process	protein phosphorylation	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0007228 all species →	Biological Process	obsolete positive regulation of hh target transcription factor activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K06228	FU; fused	EC:2.7.11.1	Cilium and associated proteins	ko03037	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_036007-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

101TPM > 0

7Conditions

9.2Max TPM

3.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	16	3.31	6.68
polyp at pH7 6	18	15	3.03	5.70
coral polyp · control treatment	16	16	3.32	8.58
coral polyp · oil and dispersant treatment	16	16	2.16	4.83
coral polyp · oil treatment	16	16	3.46	8.08
coral polyp · dispersant treatment	16	14	3.56	9.18
Polyp	10	8	1.37	2.90

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.68
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.51
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.66
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.38
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.98
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.97
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.82
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.75
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.32
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.90
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.88
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.72
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.65
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.64
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.47
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.25
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.70
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.94
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.76
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.67
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.44
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.38
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.21
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.76
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.48
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.42
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.31
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.00
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.59
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.21
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.72
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.58
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.86
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.26
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.94
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.92
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.77
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.32
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.93
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.92
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.76
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.67
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.39
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.60
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.57
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.90
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.73
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.83
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.55
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.89
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.88
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.77
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.51
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.40
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.96
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.84
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.77
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.30
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.27
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.02
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.67
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.46
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.41
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.08
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.79
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.78
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.72
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.08
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.05
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.67
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.35
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.89
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.70
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.58
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.19
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.87
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.60
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.47
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.50
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.18
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.08
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.11
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.46
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.07
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.64
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.47
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.12
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.02
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.82
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.68
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.59
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.35
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.35
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.00
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.90
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.48
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.41
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	2.15
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.38
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.06
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.72
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.64
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.00
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.