Gene detail

Detailed information of OS493_036012-T1 in Lophelia pertusa

Genomic Location: scaffold_344:35652...48191
NR annotation: KAJ7382282.1, hypothetical protein OS493_036012 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_036012-T1

ATGAAGGCTTCCAAGATGTCGGCTGAGGAGCCCGAGTTCGATGATTTGTTCTGCGATGAGGACGAAGGCGAAATAGTAGACTGGCAACTGCCGCTATGTTTCATGAAGAAACGCCACAAGGAGCTGATCGAAGGATCGAGACCTTTAGCTCAAACATGGCGAATGAAGGAGCGAATGAAGACGGTCAGCGTCGCGTTGGTCCTGTGTTTGAACATTGGTGTCGATCCTCCCGATGTCGTAAAAACCACTCCATGTGCACGAATGGAGTGCTGGATCGATCCTCTATCGATGAGTCCCCAGAAGGCTTTAGAAACTGTTGGCAATAAACTTCAGGAACAATATGAACGCTGGCAGCCAAGGGCACGCTATAAGCAGAGTCTTGATCCCACAGTAGAGGAGGTGAAGAAGCTGTGTACCTCATTACGCCGGAATGCCAAGGAGGAGAGAGTACTCTTCCACTATAATGGACACGGTGTTCCAAGAGCAACTGCCAATGGCGAGATTTGGGTGTTCAACAAAAGCTACACCCAGTACATTCCACTATCCGTGTATGACCTACAGACCTGGATGGGAAGCCCGTCAATCTTTGTTTATGACTGTAACAATGCTGGACTCATTGTTCAATCATTCGTTCAATTTGCTGCTCAGCGTGAACAGGAACAAGAGCGTTGCTTGGCCCAAGGTACCCCCATGCCAGTTCCACTTGCTGTCAAGAACTGTATCCAATTGGCGTCATGTGATGCAAATCAGCTCTTACCAATGAATCCAGAGCTACCTGCAGACCTCTTTACTTCTTGCCTTAGCACACCTATTAAGGTGGCTCTCCGATGGTTTTGTAGTCAAAAAAGTAGCAAGCTTGTTCCTGGTGTTACTCTTGACATTATAGAGAAGATTCCTGGTCGTCTGAATGACAGGAGAACACCTCTGGGAGAACTGAACTGGATTTTTACTGCTGTGACTGATACCATCGCATGGAACATATTACCAAGAGACCTCTTTCACAAGCTGTTCAGGCAGGATCTTCTAGTTGCAAGCTTGTTCAGGAATTTCCTTCTTGCTGAGAGAGTGATGAGGTCGTACAACTGTACACCTGTTTCAAGTCCCAGACTCCCTCCCACCTATATGCATCCGATGTGGCAAGCATGGGATTTAGCAGTTGATATTTGTCTCTCCCAGTTGCCAGAAGTGATTGAAAACCCAGGAAATTTTAAGCATAGTCCATTCTTCTCAGAGCAGTTGACAGCATTTCAGGTGTGGTTAGCCATGGGTGCAGAATACAGGGACCCCCCTGAACAGCTGCCGATAGTTCTACAAGTTCTCTTGAGTCAGGTGCACAGACTGCGAGCCCTGGATCTTCTTGGCAGATTCTTGGATTTAGGACCCTGGGCTGTCAATCTGGCGCTTTCTGTTGGCATCTTTCCTTATGTACTTAAACTTCTTCAGAGTTCAGCCAGAGAGTTAAGACCTCTGTTAGTGTTCATCTGGGCAAAGATACTAGCTGTTGATAGTTCTTGCCAAGCAGATCTAGTAAAGGACAATGGACATAAATATTTCTTATCTGTGTTAGCAGATGGATACATGCCGGCTGAGCACCGCACAATGGCAGCATTTGTGTTGTCAGTCATTGTGAATGAATATCCGATTGGTCAAGAAGCATGTGTACAAGGAAATTTAATTGCCATCTGTCTGGAGCAGTTGACAGACCCTCACCCGCTCTTGCGACAGTGGCTGGCCATTTGCCTTGGCAGGGTATGGTACAATTACGAGGCTGCTAGATGGTGCGCTGTGAGGGACAGTGCCCCAGACAAACTGTACTGCCTGCTGTCTGACCCACTCCCAGAGGTTCGGGCTGCAGCAGTGTTTGCTTTAGGAAGATTTGTAGCGAACACTGGGGATAGATCTGACCAGGCAAATCAGATTGACTTTGGAGTGGCAATGACATTAACACAGCTGTCCTTGGATGGAAGCCCGCTGGTTAGAAAGGAACTGGTCGTTGGTCTTCATGGTCTGGTGATGCAGTTTGAAACCAACTTTGGTGTGGTGGCACTTCAATTCCTGGAAGAGGATCGTCAAAAGGAAAATGCACCTCCTGCGGCAGCAATCACACCCAGTGGCTGGATAGTGGTTGGTTCAGGTCCGTCATCAGGCATGGAAGCCATAACACACACAAGTCCTGGCAGTGCAACCAAGAATTCTAAAGGAATGCGAGCAAGCTTCTCCACATCTCATCTTAGCAGCTTTGCAACGAATCCACCACCTGTTGTTAGTGGTCAACACATCTCACCGGCTCTCATGACTTACAGCAGTAGTAGCGGCAGTTCTGGCAGTAATGAATTTATCCCAGGCATGAACAAAGATCTGCGGCGGTCTACCTCGCAGAATTCACTTTCTTCAAGCTTCCAGTCTAATGTGTATGCAAATGTCTGGAAGTCTCTTCTCAATCTGTCTGTTGATCCTTTTGTGGGTGTCTCAGATATCGCCAAAAAGATTGTAAATGGAATAACTTTAAAGGCCACCATCACTGCGTGTCCTCGGCGGATCACATCATCAGCATCCAGTACTCTTTCCACGTCAGCTCCATCATCACCTGGGAGATTCCCGATGCCATATCATGTGGGCTCAGACCCTGGTATGTCCCCACCTCATCACAGCAGTTCGAATGAAATGCCGACTCGTTTAATGCAAGCGGATCCACCTCTTAGAAAAGGCTCCAACCCCGGTCCACTGGGGCAGCAGGAATTCCTCACTCGTATGAGTTCCATACAAAACGGAAAATGTTCGACAAAGGTCCAGAGCGCGCTAAACATCCAAGCAGCGCAAGTGAAGACAATGACCAAGAATCTGACGAAGAAGCAGGCTCCACCAAACCTCCTATGA

Transcript

OS493_036012-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8K4Q0	Regulatory-associated protein of mTOR OS=Mus musculus OX=10090 GN=Rptor PE=1 SV=1
Q8N122	Regulatory-associated protein of mTOR OS=Homo sapiens OX=9606 GN=RPTOR PE=1 SV=1
Q55BR7	Protein raptor homolog OS=Dictyostelium discoideum OX=44689 GN=raptor PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004375 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02985 all species →	HEAT	HEAT repeat	Repeat	Interproscan
PF14538 all species →	Raptor_N	Raptor N-terminal CASPase like domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR029347 all species →	Domain	Raptor, N-terminal CASPase-like domain	Interproscan
IPR000357 all species →	Repeat	HEAT repeat	Interproscan
IPR016024 all species →	Homologous_superfamily	Armadillo-type fold	Interproscan
IPR011989 all species →	Homologous_superfamily	Armadillo-like helical	Interproscan
IPR004083 all species →	Family	Regulatory associated protein of TOR	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12848 all species →	REGULATORY-ASSOCIATED PROTEIN OF MTOR	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005515 all species →	Molecular Function	protein binding	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0009267 all species →	Biological Process	cellular response to starvation	Interproscan
GO:0010506 all species →	Biological Process	regulation of autophagy	Interproscan
GO:0030307 all species →	Biological Process	positive regulation of cell growth	Interproscan
GO:0030674 all species →	Molecular Function	protein-macromolecule adaptor activity	Interproscan
GO:0031929 all species →	Biological Process	TOR signaling	Interproscan
GO:0031931 all species →	Cellular Component	TORC1 complex	Interproscan
GO:0038202 all species →	Biological Process	TORC1 signaling	Interproscan
GO:0071230 all species →	Biological Process	cellular response to amino acid stimulus	Interproscan
GO:0071902 all species →	Biological Process	positive regulation of protein serine/threonine kinase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K07204	RAPTOR; regulatory associated protein of mTOR	-	Membrane trafficking	ko04131	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_036012-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

43.7Max TPM

12.0Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	6.13	12.99
polyp at pH7 6	18	18	6.18	10.27
coral polyp · control treatment	16	16	15.84	34.43
coral polyp · oil and dispersant treatment	16	16	22.48	43.73
coral polyp · oil treatment	16	16	10.60	20.96
coral polyp · dispersant treatment	16	16	17.46	33.98
Polyp	10	10	3.42	7.81

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.99
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.91
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.16
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.86
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.78
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.41
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.15
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.72
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.37
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.10
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.97
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.94
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.79
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.41
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.95
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.82
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.13
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.84
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.27
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.17
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.05
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.96
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.30
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.25
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	7.33
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.93
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.66
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.41
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.23
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.11
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.15
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.94
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.71
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.54
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.28
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.95
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	34.43
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	29.68
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	23.01
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.27
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	20.01
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.14
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	18.97
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.00
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.07
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.60
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.47
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.93
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.79
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.88
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.81
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.32
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.73
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.67
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	32.53
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	30.30
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.71
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.37
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	22.93
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.18
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.21
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.87
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.12
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	16.42
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.09
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.97
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.84
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.67
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.96
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.33
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.72
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.50
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.97
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.69
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.50
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.09
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.26
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.97
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.32
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.75
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.13
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.06
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.06
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.34
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	33.98
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.40
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	22.44
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	21.34
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.86
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.50
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.33
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	20.04
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.47
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.84
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.29
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.60
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.42
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.45
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.79
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.53
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	7.81
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	5.43
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	3.86
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	3.54
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.26
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.99
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	2.70
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.75
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.60
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.26

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.