Gene detail

Detailed information of OS493_036039-T1 in Lophelia pertusa

Genomic Location: scaffold_345:81459...101612
NR annotation: KAJ7376217.1, hypothetical protein OS493_036039 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_036039-T1

ATGCGAGGGACCGCTGTCAGTTGTACTAGTGTACCCAGGGAAGAAAGGGATAGACTTTACGATCTTATCCAGCTGATGGGAGGCATTGTAATGAAAGACTTAACCAGTTCAGTGACTCATCTAGTTGCCGGCGAAGTGGGCTCAAAGAAATACAGAGTTGCATGTAGTTCTAATAAACCAATTTTATTACCACAATGGGTTTATAGCTGCTGGGATCTTGGTCACGACAAGCATATTTGTGCAACAGATGAAGAGTTCATGGAATACAAATGTCCAATATTCAAGGGTGTTACACTTTGCGTGACAGGTATTGATGCTGGGAAAAGGAAAGAAATCAAGACACTGATCACACAACATGGTGGAACGTACTCGGGCGAGCTGAACATGAACACTTGTACGCATCTGCTTGTTGATACTCCCAAGGGAGAAAAATATGTGTTTGCAAGAAGGTGGAGTCTTCACTGTGTTTGTACGCAGTGGTTTTTTGACTCAATTCAGTCAGGTTTCTGTCTTGATGAGTCAAACTATAGCACATTGCCTGACGAGGAAAACAACAGTTCCCATGCAGGAGCAAGATTGTCACGTAGCTTGACCAAAGACAGCAGTGTTAGTGCTGCTCCTTCTAAAAGTAACGCAGAAAAGAAAATTTCAAATAAGGCGGCACAAGCAGCATATAAGAGTGCACAGAAACATGGTGACAAAGATCTTATGTCGAGTTCTGGAAGGAAGAATTTGTTATCCAATCAATCCAGACATTTTGACAATGTTTCCAGACTGGGAGAAACTCACCTTTCCGATCTTGATAGCTCCGACTTTGATGTGAGAATCCCACCTGGAAATATGTTTCTGGATGGTTGCAAGATTTACTTGAGTGGATTCTGTGGACAAAACCTGGAGAAACTAAGAAAGATTATTAACTGTGGAGGAGGAACGAGATTCAATCAGATCAATGAGATTGTGTCTCATGTTATTGTTGGAAACAAAGTCGACGCAGACATTGAACTGTTAAGGAATTGTGACTTCCAAGTGTTTGTTGTAAATGTTCAGTGGATTTTGGATTCTGCAAGAGAAGGGAAAAAGCTAGCAGAAGAAAATTATCTCTGTTCAGATCTGATACAGAAGGAAGGACTTTCACCCTCGTGCAAGGAAAATGAAGATCCCGGTGAAAAGCTCTCAAAAGCACCAAAAAACACGCCTGTTCCTCAACCACAATTGTCAGATAATAAAAATGCAAAGAACACCAAACCCAAGGGTGACGCTTTTGAAGATGATGACGATGTCTTCCAACAGTACATGCCACAGAATTTGGACAATGCCAGTAAATCTGCAAACCTTCCACAAACAGATCATGGTATACAGATAAAAGAGAATCCTGGTGCCAGTGCTGACCCCGATGCAACACTTGATGAAGATGGTGACGCTGAGCAGGATGGCTTACTTTCTGGAAAGTGTTTCACAATTGCTGGCTTTGCAAATGAACATGTCGCGCACCTTTGGCAACTCATAGAAAGTAATGGAGGAAAATCTGCGGCCAAAGGACAAACTGCTGACTATGCAATTTTGCCAATGAATACAGTTCCTGAAGAGGACTTAAATGCAAAGCAGTTACTAACATTTTGCTGGTTAGAACAGAGCTTGGAATGTGGCCATCTATTGTCGCCAGATGATGGCTTCCTCTTTAAGCCATTCAGTATCCCAACGGCAAGCCATCCCCTCAAGGGATGTGTATTGTCAATCAGCCAGTTTACAGGAACGGAGAGAGATCATATGTATCAGCTTGCTGAGCTTCTGGGTGCTCATTGCCAGGAATACTTTGTTCGCAAGGCAAGTGGTAGCCATCAGGCCAGCACACATCTCCTCTGCCAAGATCCAGATGGAAACAAATACAAAGCAGCTATGAAATGGAACATTCCTGTGGTGAGCAGAGAATGGCTCTTTGCATGTGCGGCAAATGGCGCCTTGGTTCCCATCGACAAGTATCCAGTTGGCTGTGACAAAAAGATTGTAATGGATGCTCATCCATTAGAGAATCAGAGAACGAACAAGTCGAGTACCAAAGAAGAGCCTCAGAATGTAAATTTAAGAAGCGCAGATGAGGAAATCCCCATGGAAACTAATGATGCAGCATCCGCCATACAAGCTGTAAATGTTAACAAGGCAACTGGCAGTCATGGCAGTACTCAGAAGCAGCCAGTCAAGAGGCCATCCATTTACAATCGCCCTTTCAGACCGTCATTTGACTTGACTGATGTGATGGCAGAGTTGGCTTCACCCGCTTTTCCCAGTCTTAGAAGCAGAAAGAGTCGAGGCAGTAGAAACAGCTTTCCTCTGGATGACTTTTTTGCAGAGAACATCAAACAGACACTTCAAAAACTGGGTGCTGTTGCCCCGCCCACAAGGCAAGGTGATGATGAGGATGACAATGAAGATGAAACTACTGATGATGTACACCAGGAAGAAGAGGAACATGGAGGGTCTCCTCCACAAGGAATCCTTGGTGGCATTATTTTATCTGTGAGTAAAAAGTTGGCTCAGCAGCAAACAGAACTTTTCACCTTGGCGTCATCCCTTGGTGCTGATTATCGCTGGCTTTATGATGAATCATGCACTCATCTCATTCACCAGGGGTCAACCAATGACAAAACTAAGGAATATACCCATGCAAAGGATTGCGGCATTTACATTGTCTCTCCTCATTGGCTGTACATCTGTCAAGAGAAAAATGAAAGAGTTGACGAGACGATGTATCCACACACCTTCAACCCTAAACTAAGTCTCCCTGTGGTAACAACAGGAAGAAGAATGACAAGATCATCCAGAGCAGCAACACTGGACCAAGAGATGTCGCCTCAAAAGAAAGGAAAGTCACCAGCAGCAATGACGAGTGGGTCAAGTGAACAAAACGGCTCAGAAAAGCCAAGTACGACAAGCAATGCGAGGTCAGTAGAGTTACCTGGGGCTGAACAGGGCGTGGCAGAGGGTGTCGAGGAAGAGGTACCACAGGATCCTCAAATGGGACCTGCCACGCTGGAGTCTCTAGAAGCCAGGGAGGATTTCAAACGACAGTTAGAGGCAATCATGGATGCTACCAAGGGAAAAGGAAGGCGAAGAAGCAGGCGCCATCCGTCATCTACTAATTCAAGCAGCATTTCCCACAATGCATCAGCGAATGTAACAGCTGAGATGTCTTTGGCTACGAGACGTACGTCTTCGAGGCTGCGATCACGTGTCAGTTCTAAGGCTATCGAAGGTGATAACAGCAATTCATCCTCGCGGGTCAAATCCCGTATGCCAATAACCGATGACAGTGAACACTCGCAAAGCGACACTATCACTTACGACGATCCCGCGGGACGGATGGAGCGTGAAAAGATCATGGCACAGCTCAAGAGAGGCTGCAGTCCCAGTCCAGACTTTCACACAGAAGACGAGGAGGAGGACAGACAGTGTAACAATACACACACGAACGGACAAACAACGGTCTCGAAAGATTCTACAATCACAGGAGTCACGGTCACTGACAACAACAGCACAGTTGAGCGTCACGTAAGAGAATTGAGCGTGACAATCAAGTCCGACCCTCCCACACCCCTGTCCAGCTCTACACCCGCAGCCCCGCCCCTCGGCCTTCAAATCAAGGACACTCTGAAACCACAACCTGTGAATCTGCTAGACAATACGGACCTTGATCAAACGGAAACACGTGCTCTGACCACGCCCAAGTTCCAGCTGTCGGTCATGACGCCTCAGGAGAAGATCGATTACTCGGCGCTGATTGAGCAGCTTGGAGGTCACGTGTTTGACACTGTTTATTTTAATCCCGAGTGCACGCACGTGGTGGTTGGTAAACCAAACAGGAATGAGAAGTACCTGGCTGCAGTGTCTGCTGGGAAGTGGGTGCTTCACAAGTCGTTCTTGGAAGCCAGTCGGGAGGCAGGCGTCTTTGTGGACGAGGCGCCCCATGAATGGGGACAAGAAATCCCTGGGGAACCCCACAATAAACTTGCCGCTGCAGCTCAACGATGGAGGCTTAAACTTCGTCAAGAAAGAGCGGAAACCGGTGAAAGTGCGTATTCCCGTGGTGCGTTCAGTGGCTGGGTGGTTCTTCTGTGCGTGGACAAGTCACGCCAGCCAGGATTCAAGCGTTTGTTAGAATCTGGGGGAGCGAAGGTGTCAGGATGCAGGCCACCTTTCAAAAACACTCACGACTTTACGCACGCATTTCTAGATTTATCCAAAACGAAAGTGGAAGCGTCCGACCTGAACTCGCTACAGAGGGATAACATCTGGTGTTTAAAGCCAGACTACATCGCCGAGTACCTTATGCAGGACCCACCACCTCCCCCACAGAAATACTTGCTTGCAGAAGTAGTCACGCCGGCTGAACCGGACAGACCAGGTCTTTGTCTGTCGAGGAAAAGAAAGGGGGATGATATGACGGGAGGCGATAAAAGAGCTCGTGTTTAA

Transcript

OS493_036039-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q800K6	DNA topoisomerase 2-binding protein 1-A OS=Xenopus laevis OX=8355 GN=topbp1-A PE=1 SV=2
Q92547	DNA topoisomerase 2-binding protein 1 OS=Homo sapiens OX=9606 GN=TOPBP1 PE=1 SV=3
Q7ZZY3	DNA topoisomerase 2-binding protein 1-B OS=Xenopus laevis OX=8355 GN=topbp1-B PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0004195 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF12738 all species →	PTCB-BRCT	twin BRCT domain	Family	Interproscan
PF00533 all species →	BRCT	BRCA1 C Terminus (BRCT) domain	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR001357 all species →	Domain	BRCT domain	Interproscan
IPR036420 all species →	Homologous_superfamily	BRCT domain superfamily	Interproscan
IPR049936 all species →	Domain	DNA topoisomerase 2-binding protein 1, eighth BRCT domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13561 all species →	DNA REPLICATION REGULATOR DPB11-RELATED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0006270 all species →	Biological Process	DNA replication initiation	Interproscan
GO:0007095 all species →	Biological Process	mitotic G2 DNA damage checkpoint signaling	Interproscan
GO:0033314 all species →	Biological Process	mitotic DNA replication checkpoint signaling	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10728	TOPBP1; topoisomerase (DNA) II binding protein 1	-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_036039-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

58.8Max TPM

6.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.74	5.85
polyp at pH7 6	18	18	4.18	5.42
coral polyp · control treatment	16	16	9.77	58.81
coral polyp · oil and dispersant treatment	16	16	13.81	50.33
coral polyp · oil treatment	16	16	6.34	12.26
coral polyp · dispersant treatment	16	16	7.22	18.53
Polyp	10	9	1.41	2.48

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.85
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.73
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.55
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.75
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.67
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.28
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.06
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.93
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.78
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.36
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.93
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.93
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.84
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.78
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.72
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.64
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.43
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.06
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.42
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.32
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.25
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.19
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.98
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.82
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.59
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.47
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.36
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.25
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	4.00
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.71
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.70
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.69
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.41
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.21
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.08
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.71
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.81
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	13.45
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.04
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.96
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.19
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.36
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.13
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.97
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.52
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.07
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.83
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.31
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.22
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.18
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.69
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.67
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	50.33
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	18.19
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	17.22
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.43
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	14.21
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.93
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.51
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.14
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.28
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.65
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.27
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.03
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.98
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.89
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.41
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.55
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.26
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.68
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.13
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.49
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.14
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.78
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.63
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.71
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.29
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.88
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.69
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.54
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.49
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.39
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.08
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.26
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.53
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.85
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.63
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.25
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.02
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.74
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.71
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.67
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.62
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.62
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.68
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.11
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.62
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.51
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.76
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.21
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.48
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.13
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.87
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.56
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	1.53
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.49
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.10
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	1.07
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.92
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.