Gene detail

Detailed information of OS493_036102-T1 in Lophelia pertusa

Genomic Location: scaffold_347:295794...305950
NR annotation: KAJ7351687.1, hypothetical protein OS493_036102 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_036102-T1

ATGAGTTTTGAGCCAACAAGGATCGCAGAAGAGGACGCAAAGAGACTCGGAACTCATACAGTACGTGTTGAAGACGGAGAAATTTTGGCAAAATTCAACCGCGCGCTGGCTTCCATCGTAACTACGGAAGGATTTGCTACCCAGATGGGAGGCATTAATGGAAATTTATGCCATGTTCCCCAGAAGAAACTCAAACTGTCGTCCACTCTGTGGTATCCTGAAACAGGCCTGCATTATCCAGTCCCGGGGCTCGCTTATCACTACATTTTAGGCCCCGAAAGAGCCGTTCATAATCGCGAAAGATCATTTCATGACCCTGAGGCTGAAGCAGGTATTTTGCAGGCGATCAAGGAATACGATGAATTTGAGGAATGGATTGATGGCTCCACGAAGCTTCGCTACTCGCCCTACAGCAGGGAAGCCCAGGCACACATTTCAGGCTGGGCCATGAAATACACCAACAACCACAACAAGTTTGTGTTAAAGAAGACGTGTGTTGGAGTTCTGCTCTGTAGTGATGACTGTACTCTACCTAATGGGCTCAAGATTGTCGTCAGACCTGCTATATCTGATAAAGTTCGTGAAAGACAAATGGGTCAAAACTGTCCAAATGCCACTTGCACGGGAACGCTTGCCCACAGAAAGTGTACAGGCAACAATGGTTATCCAGTGACGCACTTCTGGGTGCATCAAGAGGACGGCATCTATTTTGAATCCAAAGGCACGCATGATCACTTCAGACCTCAAGCGAGGAGAGCAACTCCTGATAGAAACTCGAATAGTAAACTTAGCAGCGCTAAACTGAATAACGAACAGGCTGAAAACACGCCGGACGACAAGACGGAGAAAGACGAGAGCCCTTCCACATCACCGGAGGGAAAGAAGTACAAGTCTAGAAAACGACAACACGCTGAAACAGAAAATTCATTTGCAAAGGAAACTGAGATAGCGCATTTTTCCTCGTCGCTTTCATCCGGCTTGTTACGAGGATATTCTGTCGCGGAAGAGGATCAGTATATTTGCGTTACTGTACCCGAATCTGACGCGCTTTTTCACAGAGCTTTGTCATACGATCAAACAAACATCACAACATACGGGAAACTTTACCTACTCTGCAAGACTTTCCAGGATGTGGTTCCCGGATTTAACTTGCTTGAGACCCGTATGATATCACGCAATGTGATGGGATGGCCTGTTGTTATGGCGACGCTATACCGACAAGGCACTAAGGAAGGTCAAATTCATCACATGAAGACACTGGCTCGCCTCTGCTCCACGCCTGAAGAAGACTTTTTCTCACCCAGGTGGCAGATGGTTATTCACGATTTTCCCGCTGACCAGTCCCAGATGGTGACCGAGGCGATAGTTAACATGATCATCAACTCACAGGTACAGACACTGCTCAAAGTATTCCAGTATAAGAGCGTCAGCTCGCTGTACAAGATGCTGAGAGAGAAGATCACCAGCAGTCTTCAGAGCTATGACATGCACTTTGAGCTGTGTAAGAGAGAGATTATCACAAGATTACAGGATCCGCTACTGACGATGAAGTTCCGTGACATGACGCAGAGGCTCACGGGTGACAAGTGCACCACACAGGAGTACGTCAGCACAGACTGCATGCTGTCGGGGGGCATATTTGGGTCGGTCATACGAGAGTTCTGGAATTTCTGGGGCAGTAACATTGTCGCTCCTAAAGTGTTCTCTGTCGCCGGTGAGTTGGTTGGAAGAAGAGAAAAGACGGAGCAATGGCAGAAACGACAGACAGGTCTTGACTTCCCCAGCGATCCAACGAAAATAACCTTACAACGCATGAGTGAAGTGGTAGTCACGTGGTGTCACTACCAGTCTGACCATTGGCCAAAATCAGTTGTACAAGAAAGCATGGCGAGCTTCACACATCTACGCCCTGAAGAAAAACGACTCCGCTTTAACATTGAACGACCTGGGTCTGCGTTCCATCGGCCAGTCAGTTATCCCGCTATGCCCATGCCCAGATTTCACTGGCGTTGA

Transcript

OS493_036102-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q27403	Transcription factor glial cells missing OS=Drosophila melanogaster OX=7227 GN=gcm PE=1 SV=2
Q9VLA2	Transcription factor glial cells missing 2 OS=Drosophila melanogaster OX=7227 GN=gcm2 PE=2 SV=4
Q9Z288	Chorion-specific transcription factor GCMa OS=Rattus norvegicus OX=10116 GN=Gcm1 PE=2 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0009071 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF03615 all species →	GCM	GCM motif protein	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR039791 all species →	Family	Chorion-specific transcription factor GCM	Interproscan
IPR043021 all species →	Homologous_superfamily	GCM, small domain	Interproscan
IPR003902 all species →	Domain	Transcription regulator GCM domain	Interproscan
IPR043020 all species →	Homologous_superfamily	GCM domain, large subdomain	Interproscan
IPR036115 all species →	Homologous_superfamily	GCM domain superfamily	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12414 all species →	GLIAL CELLS MISSING RELATED/GLIDE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000978 all species →	Molecular Function	RNA polymerase II cis-regulatory region sequence-specific DNA binding	Interproscan
GO:0000981 all species →	Molecular Function	DNA-binding transcription factor activity, RNA polymerase II-specific	Interproscan
GO:0001228 all species →	Molecular Function	DNA-binding transcription activator activity, RNA polymerase II-specific	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006355 all species →	Biological Process	regulation of DNA-templated transcription	Interproscan
GO:0006357 all species →	Biological Process	regulation of transcription by RNA polymerase II	Interproscan
GO:0042063 all species →	Biological Process	gliogenesis	Interproscan
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_036102-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_036102-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

102TPM > 0

7Conditions

2.4Max TPM

0.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	15	0.66	1.37
polyp at pH7 6	18	15	0.75	1.98
coral polyp · control treatment	16	16	0.85	1.32
coral polyp · oil and dispersant treatment	16	15	0.89	2.05
coral polyp · oil treatment	16	16	0.73	1.31
coral polyp · dispersant treatment	16	16	1.18	2.37
Polyp	10	9	0.49	1.27

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.37
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.32
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.12
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.97
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.89
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.83
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.83
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.78
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.77
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.62
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.61
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.60
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.48
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.45
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.31
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.98
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.83
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.33
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.19
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.00
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.94
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.85
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.76
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.72
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.64
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.60
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.53
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.52
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.43
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.27
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.32
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.09
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.08
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.07
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.96
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.96
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.93
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.93
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.87
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.87
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.78
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.75
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.60
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.50
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.47
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.39
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.05
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.46
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.20
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.16
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.06
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.02
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.95
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.90
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.85
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.81
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.79
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.61
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.51
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.43
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.37
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.00
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.31
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.23
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.05
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.90
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.82
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.81
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.80
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.79
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.78
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.71
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.70
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.53
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.40
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.32
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.25
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.22
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.37
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.33
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.82
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.62
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.44
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.38
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.37
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.31
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.03
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.02
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.02
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.77
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.49
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.42
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.38
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.19
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.27
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.96
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	0.69
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	0.62
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	0.49
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	0.47
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	0.18
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.12
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.10
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.