Gene detail

Detailed information of OS493_036137-T1 in Lophelia pertusa

Genomic Location: scaffold_349:16688...46385
NR annotation: KAJ7388698.1, hypothetical protein OS493_036137 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_036137-T1

ATGTTCTTCATCCTCTTATTCTTAATTTCATGGTTCCCTACGACTTGCGGAAGGCTTCAAGCCGTCTGCTCGTCTGGCATGAATGTTTTAAATGACCAGAATGCGCCTGCACTGATAAAGATCACGGGAAGACTTTCTAACGATAATCTGCAGCGTTCCTGCGTTTTGAGGGTGGACAAACCAGATAGCTTTTTGCGTGTGAGAGCTAAAAGGAATGACAACTCTACAGGTTTCTTGCACATTTTTTTGTATGAAGGAGGTGGATCGGCATTGCTTGGTCATGTGGACGTGTCAGAGCCGGCACCTGTTTGGAACACTCTGGCCCTTTGTCCAGCTCCTCGTTCAGTCCAAACATTGGGGGAAAAGTACATGTCAGTTTTGGGGACAAGTGGCCTTTCTTTTACAGTGGAAATAGCTGACAGTCCATCAGAAGTTATGTTGAATAAACCACAGGAAGCCAATGTCGAGAGTGACAACGTGATGGTGTTCAGGTTCATCCCGCCTAAAGGTATCTCAAATACACAACTTGACATCACGGTCACTTCCCAGTCAAATGTACCAGCTTACTTAAAGGTATCGCAAACATGTGAAGATGTCCAGGAAAACATAGAAGTTATAGATTACAAGAAGGAGTCACTACGTCTTTCCTTTGCAAGGAAAGGACGGATTACCCTGTCGAAAGCTTCTGTTCCCCCTTTGACTGACTCCGACTCTAGCTGGTTCATTGGAATAGCACTTAAGAACGCTACAGGCAGTGTGAAAGTTAGTGAATCAAAATATGTTACTTTGGAACTGAAAAAGTCATTTGATTACAGTTATACAACACCCATTTGCACTTTAATTTTTGTATCACTATTAGGAGGTATAGTAATGTCGATCATTGCATTGCTGCTTTTTAAGGAGTCTCTTGTAGTAGTAAATACTCTTAATGCAACAGCAATAGCTAACACGTCTGAGGCTAATACGGGACACCAAGAACTCCTATACCGTCCACCTGGTGATAATAATCAGGGTAATAATAATGGCGTCGAAATGAATAAATGTGCAAAATTTGGGAACTTCATTGTAGCCATGCTGGAGGTAGCATATAACTACTGGTTTTCAGGTGGTCCAAAGACCTTCTCTTATATTACAGGCATTGTGGGTTTTGTACTAATGATCGGCGCTTTCCAGTTTGTCTTTGCAAACTGGTATATAATGATACAAGAAGGTGACAGAGACAACTGCTATTACAACGACTTTTGCTATAGAGTTACCAGTCATGATATTCCATTTAACTTAATGATAAGTAACTTAGGTTACATAATCCATGGTCTTATCTTATTTGTTTGTGTATGGTACATGGAAACAGAGCTGTATCTTTACTGTAAAAGCCTTGAGAATTCCCCCACGACTGGTACAAGCGATGAACAACAGGACATCCTACCAGACCATGTTATGGAATGTCCTAATATCACTCTACATATTCTAGAGGGGGCTGTTCCGAAGCATGCTATTGGGGCAGAAGAAAAGGCGAAATTGAAGGCCCAAGCGCTGAAAAGGAAGTATTCCTTTTCCATTGGGTATGCTTTCGCTTGGGCGCTACTTTTTGAGGGATTGTTTTCCACGGTTTACCATTTGTGCCCAAGCAGGTTAACATTTCAGTTTGATTCGGCATTCATGTTTATAATTGCCAGTTTAACTATTCTGTTGCTGTATAATGGTATTGAAGTGAATGAGTGCCCTAGTTCTGAAAGAGCAAAGGACCCAGTGGGTGCCTTAAATTTCTTTCTTTTTGTCATAGTGCCACTTTTCATCTTCAATTATTTTGGTATACTCTATCACTCAGAAACTGGGTTGACCAAAGCATTACAAGTGATTTTTTTAATATTTCTTATAATTTGGTGGCTTGCAGTGGTTCGCTGGGCTTTCTATAAGCTAAAAATTCGCAAAGAGATTTGTCCAGGAAACACTTGTGGAACTTGTTGGAATGAGTGTTATTTCTTTCTGGGTGGTTTGGCAGTTCCTCTGTTATTGTTTTTGTTATATGTATTTTATTTTAGCGACCTTTCTCAAGCGTTCCTGATAACCTGTATTGCAGAGAGTCTTGTTGCAATTATTGCCAAAACTAAAACATTACAAAGGCTATGGGCTGCACTAATGTCACTGTGCTGCAGCTGCAGGCCATGTGAGTGCACATGGCCAAAAGCAAAGGACTTTTTTCCGGGAGTTTATATCTTCTTCACTGTTGCTTTTTTGGTAGCAGCTCTTTGCGTTTTCCAAATACTAGCTACCACAGACAAGACGTCATCGCCCGAAGACTCCCGTGATAAAAACGGAGAATGTATAAAACCTTTTGGCGGGTTTTTCGACTGGCACGACCTTTGGCATGTTTTGTCTTCTTTTGCCCTACTCATGGGAGCATTTGTTGTCATGTTTATAAGTCAGGGTGAACAAGGGCAAAGTAATGAGAATTCGAGTAAGGTATCTGAAAATATAGCAGGAGAGAATATAGCAGGAGAGAATACAACTGAATTGAACGGTGGTGAACAAGGGCAAAGTAATGAAAATTCGAGTAAGGTATCTGAAAATGTAGCAGGAGAGAATACAACTGAATTGAACGGTGGTGAACAAGGGCAAAGTAATGAAAATTCGAGTAAGGTATCTGAAAATGTAGCAGGAGAGAATACAACTGCATGA

Transcript

OS493_036137-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8CIF6	SID1 transmembrane family member 2 OS=Mus musculus OX=10090 GN=Sidt2 PE=1 SV=1
D3ZEH5	SID1 transmembrane family member 2 OS=Rattus norvegicus OX=10116 GN=Sidt2 PE=1 SV=2
Q8NBJ9	SID1 transmembrane family member 2 OS=Homo sapiens OX=9606 GN=SIDT2 PE=1 SV=2

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0001213 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF13965 all species →	SID-1_RNA_chan	dsRNA-gated channel SID-1	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR025958 all species →	Family	SID1 transmembrane family	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12185 all species →	SID1 TRANSMEMBRANE FAMILY MEMEBER	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0016020 all species →	Cellular Component	membrane	Interproscan
GO:0003725 all species →	Molecular Function	double-stranded RNA binding	Interproscan
GO:0005764 all species →	Cellular Component	lysosome	Interproscan
GO:0005886 all species →	Cellular Component	plasma membrane	Interproscan
GO:0050658 all species →	Biological Process	RNA transport	Interproscan
GO:0051033 all species →	Molecular Function	RNA transmembrane transporter activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_036137-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_036137-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

10.4Max TPM

3.5Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	3.78	6.74
polyp at pH7 6	18	18	3.01	6.23
coral polyp · control treatment	16	16	3.62	9.12
coral polyp · oil and dispersant treatment	16	16	2.64	6.14
coral polyp · oil treatment	16	16	2.89	5.08
coral polyp · dispersant treatment	16	16	4.19	9.45
Polyp	10	10	4.85	10.44

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.74
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.18
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.12
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.31
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.20
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.03
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.93
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.67
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.50
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.27
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.01
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.93
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.85
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.84
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.59
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.58
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	2.52
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.85
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.23
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.11
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.80
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.75
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.40
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.28
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.07
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.48
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.36
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.19
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.17
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.03
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.99
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.88
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.72
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.46
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.33
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.02
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.12
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.42
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.05
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.21
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.15
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.60
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.20
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.12
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.83
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.74
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.52
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.40
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.10
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.89
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.01
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.66
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	6.14
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.52
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.33
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.67
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.61
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.57
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.45
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.39
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.12
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.12
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.78
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.69
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.62
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.54
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.45
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.29
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.08
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.65
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.71
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.53
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.45
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.40
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.28
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.12
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.07
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.00
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.64
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.28
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.71
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.55
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.44
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.31
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.45
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.61
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.09
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.66
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.12
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.66
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.27
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.17
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.29
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.15
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.66
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.57
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.46
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.33
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.87
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.60
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	10.44
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	8.84
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	8.40
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	7.10
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	4.47
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	3.25
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.90
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.54
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.88
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.66

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.