Gene detail

Detailed information of OS493_036395-T1 in Lophelia pertusa

Genomic Location: scaffold_361:240462...273125
NR annotation: KAJ7388679.1, X-ray repair cross-complementing protein 5 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_036395-T1

ATGGCGGCTGCAAAGGATGCTGTTGTTATTATTTTGGATGTTGGGCCATCAATGTGCCAAGCACCTCCTGGCCATTCCACCTATTTGGAGATTTCTGTAAAGGCTATCAACATGATAATACAGAGAAAGATGTTTGCAAACACAAAGGATGAATTTGCTATAATTCTGTTTGGTACTGAAGGAACGTCAAATCATCTGAATGGCGAGCATCATGAAGGCTATGAAAACATTACAGTGGCCCGTGGTCTTAGTTTACCTGACTTAGAACTGCTTCGGTTTGTTCATGAACAGATTACACCTGGTAATGTTGAAACAGACTTTATCGATGCTATTGTAGTTGGCATGGATTTGTTGCGAGAACACACAAAAGGCAAGAAGTGTGAGAAAAAGATCTACTTGTTCTCTGACCTTGGTTCACCTTTTGGTAATGACCAGCTGGAGGCCATCACTGATGGCTTAAACAACATGGAAATCCATCTGACATTAATAGGACCGGATCTTCATGATGATGGTAACGAGGATGGCACAAGTGATGTAGATGAAAGTGGCCCTTCAACATCGACTGCTGATCACAGAAAAGAGAGGACAGCACAACAGGTAGCTGGAGAGAATTGTATGAGACAGTTATTAGAGGCTTTAGATGGGGAGACATATTCCTTCAGTCATGTTCTTCCAATGCTGAGCTTTTTCCAGACAAGATCAATCAAACAAACTACAGTGTTCAGAGGACCCCTGGAGATTGGTTCACAGTTAAAAATAAATGTCTATGGATACAACAGGGTAAAAGAAGAGAAACTAGCATCATGGAAAAAGCTATCAGCAGTATCTCAAATGTCCCCAAACCCAGACACAATGGAGGTACAAATGCAGAGGTCACATCACTTGAAAGATGAAGATGACACTGAAGTGGAGAGAGAAAATGTTGCACAAGGTTATCGCTATGGGAAGACACTGGTTCCCTTGACCAAGATTGACAGGGACAGTATGAAACTTCCGACAGAGAGATGTTTATCTGTGCTGTGTTTTGCTTCAAATGAAAATGTTGAAAGATATCAGTACATAGGAGAGAATGTTATAGCTTTTGTTCCCCAGCCAGGTGACCAGCATGCTGCAGTTGCACTGTCAGCATTCATAAATGGCATGTATGAACTGAACACTGTAGCAATTGTAAGATATTGCCGAGTAAAGAATGCTGCCCCAAGGCTTGGTTTTCTGTCTCCACACATCAAACAGGACTATGAGTGCCTCCTGTTCACTGCACTGCCATTTTTAGAGGACCTTCGACAGTTCAGCTTTACACCTCTTAATTTCAACAAGAAGTGGGAGCCCTCTGGAGAGCAACAGGATGCTGTGGATAATCTCATCACGGCTATGGACCTGACAGATGCTCACCGTGATGAAGATGGGCAGACTATAGAAGCACTAAAATGTAAAACAACCTTTAATCCAGTTCGACAAAGAGTTTTTCAGTGTATTCAACATCGTGCTCTTAATCCAGATGATCCATCTTTACCAGATTTAGAGCCTGTTATTGCAAGTTACTTGGAGCCCAGTGCAGAATTCAAAGCAAGGTCTGCTCCACAGTGTACTAAAGTTAAGGATATGTTCCGTCTTGAAAAAATCGAGAAGAAGAAAGAAACAGCAGCTGAAAATGTCTTCAAAGCAATTGGTGACGAGGCAAATGGTGAACCATCAACCAGCCGAGCAGCTGATCATGATGAAACTGACTTTAGTATGGCAAGTTTGGCAAAGAGACAAGTCACACAGGTTGGCACTGTTGATCCTGTTGGAGATTTCCGTACTATTATCAGTCAAAGGGACGAAGATAGGTTTGATGAAGCTGCCAAACAGATGAGGGCGCGTATCCTGCAGTTAGTGTTGGATTCATTCAGAGACCAGTTCTATGCCAAGGCCTTAGAATGTGTAAAAACTCTGAGGGAAGAAGCTATAAAGGCTGGTGAATCTGGGATGTTAAACACATTCCTTCAAGAAATTAAAGAGAAGATTATAAACCAAAGAGGCCATGAATTTTGGCTTCTGCTGTCAAAAGAACAAGTAACACTGGTCAGTCAAACTGAAGCTGCAGATAGTAACATCACTGAGGCTCAAGCTAAAGAATTCTTGGAAGATGGAGCAGCTGAGAAAGAAGAAGTTCCAGTTGATGACGCAATGGAGGATGCTGACGATTTGTTGGAGATGATGGAGTAA

Transcript

OS493_036395-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q6DDS9	X-ray repair cross-complementing protein 5 OS=Xenopus laevis OX=8355 GN=xrcc5.L PE=1 SV=1
P13010	X-ray repair cross-complementing protein 5 OS=Homo sapiens OX=9606 GN=XRCC5 PE=1 SV=3
P27641	X-ray repair cross-complementing protein 5 OS=Mus musculus OX=10090 GN=Xrcc5 PE=1 SV=4

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003599 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF02735 all species →	Ku	Ku70/Ku80 beta-barrel domain	Domain	Interproscan
PF03731 all species →	Ku_N	Ku70/Ku80 N-terminal alpha/beta domain	Domain	Interproscan
PF08785 all species →	Ku_PK_bind	Ku C terminal domain like	Domain	Interproscan
PF03730 all species →	Ku_C	Ku70/Ku80 C-terminal arm	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR006164 all species →	Domain	Ku70/Ku80 beta-barrel domain	Interproscan
IPR036494 all species →	Homologous_superfamily	Ku, C-terminal domain superfamily	Interproscan
IPR005161 all species →	Domain	Ku70/Ku80, N-terminal alpha/beta	Interproscan
IPR016194 all species →	Homologous_superfamily	SPOC-like, C-terminal domain superfamily	Interproscan
IPR036465 all species →	Homologous_superfamily	von Willebrand factor A-like domain superfamily	Interproscan
IPR014893 all species →	Domain	Ku, C-terminal	Interproscan
IPR005160 all species →	Domain	Ku70/Ku80 C-terminal arm	Interproscan
IPR024193 all species →	Family	Ku80	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR12604 all species →	KU AUTOANTIGEN DNA HELICASE	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0003677 all species →	Molecular Function	DNA binding	Interproscan
GO:0006303 all species →	Biological Process	double-strand break repair via nonhomologous end joining	Interproscan
GO:0003678 all species →	Molecular Function	DNA helicase activity	Interproscan
GO:0000723 all species →	Biological Process	telomere maintenance	Interproscan
GO:0003684 all species →	Molecular Function	damaged DNA binding	Interproscan
GO:0005634 all species →	Cellular Component	nucleus	Interproscan
GO:0006310 all species →	Biological Process	DNA recombination	Interproscan
GO:0042162 all species →	Molecular Function	telomeric DNA binding	Interproscan
GO:0043564 all species →	Cellular Component	Ku70:Ku80 complex	Interproscan
GO:0003690 all species →	Molecular Function	double-stranded DNA binding	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

KO	Enzyme	Enzyme ID	Pathway	Map ID	Source
K10885	XRCC5, KU80, G22P2; ATP-dependent DNA helicase 2 subunit 2	-	DNA repair and recombination proteins	ko03400	deepkoala

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_036395-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

26.8Max TPM

7.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	8.58	13.81
polyp at pH7 6	18	18	8.25	11.55
coral polyp · control treatment	16	16	7.30	19.36
coral polyp · oil and dispersant treatment	16	16	5.48	24.80
coral polyp · oil treatment	16	16	7.61	20.10
coral polyp · dispersant treatment	16	16	6.12	11.62
Polyp	10	10	13.64	26.84

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.81
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.87
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.00
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.83
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.50
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.88
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.53
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.41
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.05
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.83
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.75
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.64
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.60
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.42
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.89
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.50
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.97
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	3.93
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.55
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.49
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.28
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.10
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.62
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.42
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.11
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.89
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.65
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.90
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.77
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.44
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.35
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.19
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.90
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.66
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.64
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.52
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	19.36
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.88
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.48
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.63
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.43
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.20
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.72
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.46
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.47
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	6.17
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.63
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.12
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.31
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.80
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	3.73
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.35
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.80
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.38
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.09
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.89
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.84
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.61
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.07
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.04
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.50
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.39
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.30
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.11
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.45
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.16
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.08
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.97
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	20.10
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.37
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.83
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.37
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.09
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	9.14
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	8.55
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.87
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.62
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	5.27
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.97
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.50
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.94
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.95
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.82
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.37
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.62
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.74
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.17
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.77
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.17
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.84
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.61
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.39
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	6.01
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	5.12
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.24
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.17
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.15
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.88
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.56
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.50
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	26.84
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	21.40
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	19.36
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	15.13
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	11.22
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	10.92
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	9.49
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	9.29
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	7.09
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.67

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.