Gene detail

Detailed information of OS493_036442-T1 in Lophelia pertusa

Genomic Location: scaffold_364:287751...305557
NR annotation: KAJ7369799.1, hypothetical protein OS493_036442 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_036442-T1

ATGGCTTTACGAAATCGAGTTCGTAGCTTCCTTGGCCTAGATCGCTCACAAAAGGATTCTCTTGATGGAGGCTCAACAGAGAACCTTTCAGAAATTGTATATAAGGATGATGCTCGTGAATTCCAGGATGACCCTCGTACTGATGAAGAGGTGTTAGGATCAATAAAAGAGATATATTTCAGTGATACTTCATTTGATTCCAGTGATCATGAACTTCATAAACTTCCAGAAGTCCTAGATCTTGACGACCTTGATGATTATCGAAATGACCTTCGACGACAGCTCCAGTCGGTCTCAAAAACACTTTACACAAAAGTTTTGGAAAACCACAGTGCTTATGTACAGGAATTACAAAGAGTGATGGACCTACAAGAGTCATTACACACCGCCTCTTCAATCTGCGACAGAGGAAGAAGACACTTGGATCGCGCAAAAAGAGGAGTATCTGTTGGTGGGTTAGGAATTTTGGCCAAACATCGCAAGAAACAGCATCTACTCATTCTTCTAGAGTCTCTAAGGACAATTAAGACATTGCAAAGGACAGATGTCAGACTTAAAGAAATGCTTGAGGAAGAAGATTACCCGGGTGCCATTGATTTGTGCCTTGAGTGTGAGAAAGCAGCTAGAGCATTCAAACATTACAACTGTATAAGTGAACTGAGTTCCAATCTCCAAGAGACTCTTATAGATATTGAGAAACAACTCGATGTGGCCTTAGGGAAGATGTGCAAAAACTTCACTCCTGTGAATTACGAACGTCTTCTGACTGCCTACCGATACTTGGGCAAGACACAGATTGCTATGGATAAGCTGATTATACATTTCATGACTGCCATCAATCATGAATCATTTTCTGTTTTGATGGTTCATATTGGGGAATATACTTCAGAAGCTATTTCTGAAGATGGCTTCCAGCATCTTCATTTTGAAGAGCAGTGCAAGAAAGTCGGAGTGGACCATTTTACTCCATGTTTATTGGATCTGTGTAAGGTGCTGTGGTCGCTCATGTTAAGCTATCACCAAATTATCAAGTGGCATGAGCAGTATGATCCTGCTATGCACATAAGTGAGGCTGAGCAGGATGAACCATCTGCTGAGGCGACTTACAACAAGAATTACATTCAACAGAAACTAGAACATGGACTTAATAGGATATGGAAGGAAGTCCAAGAGAGAATCAAGACACATGTTCTTGCCCATGATTTATCTTATTTTAAATATGATGACTTTATTTATGTATTGGATCTTGTGAACAGATTGATTGCTGTTGGTGAAGAGTTTTGTAGCAGTACGTCAGAAGATCTTCACGACTCCATCAGAACACAGACTGTCAAGTATTTTAAGACATACCACAGGTCAAGAATGGATGAACTACGAATGTTCCTGGAAAATGATGCTTGGGAGTTATGTCCAGTTAAAGCATCATTCAAAATCGTGGACCTTTCAGAATTCCGTTTTATGAAACACCAGCAGCAGCAGCCTCTGATCAAAACTCACAAAAGAACAGCTTCTGGGACAGTTCATGTCACCACAGAAACAGGTTTCTTTTCACGGTACTCCTTACACGGCAATCCTTTTGATGATGTGTATGTTGAAGATGAAGCTGAGGATGTGTTAGCAGAGAACGGAGAAATGATAGACGGTGATGTGAATGAAAACGATAAACGATCAAGAGGACTTAGTCAAGATGATGACGAAGAAGACGATGAAGATGAAGATATTCCAGAGGAACTCAAACTGGATTATGTGGATGAGAGGACTGGTGAAATCCCCTCCAGCAGGGCAGAAACATCTGCTCATAGCAGAAAGCACCAGAAATTTTTGTCCAAAGTTCCTTGTATCACAAACACAACTCTTAATGTGCTGAGAGTGTTTGGTAAATACATGCAAATGATGAATGTATTGAAGCCTATTGCCTTTGATGTGGTCATCTGCATGTCTCAGTTGTTTGATTATTATTTGTTTGCTGTTGCATCATTTTTTGCCCCAGAAGTTATGGTGGATGGTAGTGCCCATGGTTTGAGTATCAAGTTGAGGACAAGTTTAAAAAGAATCGGAGATAATCTTATTCATCACGTAAGTGACACTGGTTGGTAG

Transcript

OS493_036442-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q96JG6	Syndetin OS=Homo sapiens OX=9606 GN=VPS50 PE=1 SV=3
Q8CI71	Syndetin OS=Mus musculus OX=10090 GN=Vps50 PE=1 SV=2
F1LSG8	Syndetin OS=Rattus norvegicus OX=10116 GN=Vps50 PE=1 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003524 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF10475 all species →	Vps54_N	Vacuolar-sorting protein 54, of GARP complex	Repeat	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR040047 all species →	Family	Syndetin	Interproscan
IPR019515 all species →	Domain	Vacuolar protein sorting-associated protein 54, N-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR13258 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000149 all species →	Molecular Function	SNARE binding	Interproscan
GO:0032456 all species →	Biological Process	endocytic recycling	Interproscan
GO:0042147 all species →	Biological Process	retrograde transport, endosome to Golgi	Interproscan
GO:1990745 all species →	Cellular Component	EARP complex	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_036442-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_036442-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

94.9Max TPM

41.2Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	48.33	69.73
polyp at pH7 6	18	18	47.11	73.50
coral polyp · control treatment	16	16	45.22	68.04
coral polyp · oil and dispersant treatment	16	16	33.30	48.52
coral polyp · oil treatment	16	16	47.40	61.54
coral polyp · dispersant treatment	16	16	26.89	43.94
Polyp	10	10	37.29	94.92

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	69.73
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	66.82
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	66.61
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	66.51
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	61.30
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	59.60
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	48.22
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.76
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	47.03
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	45.79
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	42.48
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	41.00
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	39.36
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	37.87
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.15
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.65
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.22
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	25.82
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	73.50
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	67.79
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	61.32
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	60.84
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	59.87
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	58.94
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	58.29
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	55.71
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.95
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	48.18
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	42.01
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.97
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	39.02
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	35.62
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.53
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	28.18
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.61
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.55
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	68.04
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	58.95
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	57.35
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	57.02
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	54.45
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.80
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.41
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	47.29
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	46.17
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	42.23
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	41.14
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	39.44
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	35.29
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	33.42
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	25.70
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	21.87
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	48.52
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	43.03
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	41.18
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	39.71
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	38.64
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	37.28
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	36.72
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	33.42
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	31.99
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	29.08
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.77
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.00
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.24
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	25.16
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	24.57
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	21.44
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	61.54
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	61.43
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	58.21
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	55.48
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	53.40
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	50.03
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	49.33
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.54
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	47.34
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	46.87
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	44.99
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	43.82
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	41.25
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	38.60
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	31.17
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	27.37
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.94
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	43.36
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	42.25
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	39.64
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	36.66
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	35.58
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	30.00
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	26.56
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	24.68
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	23.10
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	19.43
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	18.46
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	16.68
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.03
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.71
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.18
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	94.92
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	58.28
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	55.10
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	48.50
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	35.67
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	20.95
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	20.16
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	16.69
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	12.02
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	10.62

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.