Gene detail

Detailed information of OS493_036638-T1 in Lophelia pertusa

Genomic Location: scaffold_376:31485...71448
NR annotation: KAJ7369746.1, Protein zgrf1 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_036638-T1

ATGTCTTGTGATAAGTTCTCGGTACTTTACACTCATCAGAAGACAAAAAAAGCCAAGACATGGCAGGATGGCATTTTGAAGGTTATAGGAACTAAGGCCGTGCTTTGTGATGAGGATTCAAAAACTCTGGATTCTCTCTTTGTACGTAGAGATCAGGTGGCCCCAGGGGAAGAGTTAGAAAGTGAACGATACCTAATAACTATTGATGAAAGACTGCACCCCTCAGCTGACCACACCCATGGGGTCACTTCAAAGACACAGGAAAAGGAAGTGAAAGACTGGGCAGGACTTCACTATCAACCAGGGAAGAGGAAAAGACAGTGTTTTCAGCCACCGACATTCAACCAAGAGAAACCTGTCATAACTGGTTATACTGAACCTGAAGTCAAAAAGCCAAGAGACGAACATTTTATTCCACCGCGTCCTAATAGCGGATTAGGCATGACAAACAGACCTCCGAGTAATACCGACTTTTCAACATGTACAGTGCTCATTCCAAGAAACGAGAGAGTAACAGTTATCAATGCTACGGGAAAAGAGAATCGGTTCGCCTCTAGAGGTGGACCTCCTGCTTTCACATTTTCGACCAGTGACACTGAAAACAAACGCGACACTTCTCAGATTCTTGCACTCTTCACGTCGTGTAAGGACATTCCACAACCTAAAATGGCACTCGATGGACAAAGCACAAAAGTTAATGACCTAAATTCTGCAGCTATAGAGGAGAAGCGATTGATATCCAATTGGCATGGCACTGCGGATAGCAATTCATCTCAGATGAATACAGTTAAATTATGCGCCCAAACAAACAGCATTTCTGAAGCTGCAGATCTTTCGTTGCAATCAAACACTGTGAACAAGGATTCTCTCGATCAAGAGCTAGAAACGAGTCAGGATTTAGGCGACTCCTTAAATTTGTCTCCAGATTCGTTTGCAGCTTGCTCTAGTGAAACAAGACTGATAAATACCTTGCTTCCAGGTGGTGATTCTCAGGAAAATAATGGCGGTGATGTTGCCGGGGGAGGCACAATGTGTGAAGATAGTACACAAGAGTCAGCATTTAGCAAGTCACCATGTGACATTGAGAGGCAAAATGAGGTTTGGTTTCAAAATGATTCTGAGTCAGTCTCCCCCCTGATGAGGCTCCTGTCGAGTGTGGAAAATGATTTTAACGAAAGCGATCCTCCAACTTGTGTCGATTTGAAGGAAGATAGAGGCCATGTTAACGCAGTAAGAGATAGCAGTCTATTAGATGACTACAACTTTCAGGGACGTGATTCAGCTAACGTGGAGCATCGTTCTTCAGGTTTACATCCATCTGACTTCCCGAATCTGTATTCAACACAGCAGTCTGCACATATGAAAACAAATAGATTCCCTAGCCATCCAGGGTCGTTGTTTGCATACAGTGGACTGCAAAGTCAAGATCAAAATGACTGCTCAAGGAGTTCTTTGGACTCAAACATGTTTGAAAAAGGGATCAATAGTTTGGAGCAGTGGGACCCACCATCTTTTGAACGAAATGGTGTTGATGACATTGGAGTAAATTTTCTGCAGTGCGAGGTTTCACCAGAGTTCTACCCATCAGATAATGAGAAAACGACTCAGTGGAAGGTTGCTCCTATTGTGACAACCAAAGTAATTCCCACTGACAACCGAACAGTGACTGCAGGAGATGGTCACTCGTGGAAGGGTTCAGTTGTCAGTGACACAGTTAAGAGAGGGTGTCCTTCTGTGCCTATGGTATCCGTTCAAAGGAAAGATGTCTACAGTCAACCTAGTAATGGCGACCAAAGGGCTCCATCGTCGGACTTTACCTGGATTGACTCAATTTCATCGTCTAACGCTCATAATGAGTCGCCATGTCTTCTATCCACACAAGGATTTGCGACGAGTGAAAGTATCGCGTTGTCTTCCACTGAGGGATTCATTAGGAATAGCCAGCTAACAGAGGAAAAGCTTGTAGAAACGCCCGAGTTTGTACAAAGAGTGCCTCGACTGTCCAGAAGAAGAGCCCCCTTAGTTACTGCTCCGCCTGAAGATCAGGACACGCCGTGTACAATTCCGCCAAACACAGATGTTTACCGTGAACGGCTAACTGGAACATGTGCCACAGAACTCCCTGGCGTTTGTCGCAAAACAACTTCAACAATTGGAAAACGGTCAATTGGACTATCCCAGAGAGAAACCACTGAGCCTTCTGCAGCCAACGTTGGAAATCTTACGGAGAAAGGGAATTCGACTTTGCTTGGTTCTTGCCGACGCGTAGGCCTAAGGAGGGTGGGGCTGGGATGTACACGTGACCTCCCCGATAGTCAAAATGCGATGTCTCAGACACGACAACAGTCGAGCCAGAAGTCGGATGGTTACAGACCTCCCTCTGCACCGGGATTCGTGGCTAACACTTTATCTGGAGACCGTAGCATGGCTGGTGAGTTGTGTTTTCCATCAGCTGAGGAGTGTGACGGTAGTGTCACGCCAACTCGGCATGTCACTGTCCCCGTGACGTTCGAAAATGTCATGCAATATAGGCAATTGTTCAAGGCAGCTTTGAGAGAACACCTGAATGTAGTTTTATTTGAGCTGGCTCGTACCTACCACGCTGCTCTTCAGAAGGTTGACGTATCAGGGTTTGGTGCCCACGAGCAAGGAAATCGTCAAAGTTCAGATGGTCCGTGCTGTCCTCATGGTCAGGCACGTTTGAGAGCTGTTAAGAAGGATGGTGCTAACAAGGGAAGGTTGTTTTATACCTGCCCAGGAACAGGACAAGCACAGTGCAAGTTCTTCAAGTGGGCAGATGAATACCAAGCCAACAAGTCTGGGTCAAAAGGAACGAAGCACAATACCTCGAATAAATTGACACTATCATCTTCTGAAAGCTTGATGGCCTTCTTTAGAAGTTATAATGTTGCATTTTACTCTGAGTGCCATCTGATAAGGAAAAACTCGGACGCAGGGAAAGGAAAGTTTGGTGCTAAAGCTAAGAAATGGGGAAGGCAAAGGAATGGTGATGCTGATAGTGGAAAGAAAGGACTCTACTTGGAACTCTCACGAAAAGATCATTCATCTACTTATTCAAAGGATGACATCTGGATCATATCAAAGACTTTGTCGTTCAATCCAGATTCAACATTCATAGCAAGCAGTGCTTATTATGGACCGTCCTCTAGCGGGGAGCTAGAAATACTGCCAATCAGCGGTTATTCTCCTTCCAACTGGCAAAGCGGAGAAACCGTGCATGCTTTGTTGGCTTGCAATGCTGGCACTGAACTGACTTGTATCAGTAACATTGAGGAACACGTCAAGATGCAGAACATGCCAGTACTTCCGTTCATTCTCCAGAGAGGACAGGGCATGGAACCAAATATTAGGAACCCCTCACGTGTCTCGTCCTTTGTTCCGCCCACGCTAAGGACTTCCGGTGGTCAGCTGGATCTACCATTAGAAGTAACGGAAAGTTTAGCCGAAGAAATGATACTTCGTTTTAATTTAAACAAGGATCAATCATCCGCTCTGCTCTCTTGTGCAAATATGTTTAACCCATCTATAGCCGACGGCTCTTCTCTGCCAGTTTTGTTTGATACACGAGTTCCCTTTCTCTTACTTTCCTTGCTAAATCGAAGGGTCATAGTTGAATTACTGAAAAAGGGCGGTGGTGGTGGCGTTTTTGGTGCGGGTAAAAGTTTTCTACTTGCCGTTGTTGTTCTGTATCTGGTGGAGTTATTTAAAGCCAGTGATGCTTTTCATCAGCAGAGTAACACTGCATCGTCGTGGAAGATCCTGGTGTCCTCTACAACAAACGTCGCAGTTGATCGCATTTTGTTAGGGTTGTTGGAACTCGGGTTTGAAGAGTTCGTTCGAGTTGGAAGCATCCGTAAAATCGCCAAACCAGTGTTACCCTACAGTGTACACAGTACGGGTAATGACAGCCAGGAGTTAAAGGAACTGCAATCGCTACTGAAGACTGAACTGACACCATCCGAGAGAACCCACGTCCGAAAAGGCATTGAACAACACAAACTAGGAGAAAATAAAAGGAAATTATCCCAGGTCCGAGTGGTTGGAGTCACATGTGCGGCTTGTGTATTTCCTTGCTTGCACAAGTTAAAGTTCCCGGTGCTACTTCTGGACGAGTGCAGTCAAATGACAGAGCCTGCTTCTCTTCTACCCATGGCCAGGTTTGAATGCCGGAAGCTTGTTCTGGTTGGTGACCCAAAACAACTGAGTCCGACGATTCAAGGATCAGAACCTGAACACGAAACTGGACTTGAGCAAACAATGTTTGATCGCCTCATGAAGATGGGTTATGAGCCCACTCTGCTTAGAACACAGTACCGTTGTCATCCGGCCATTAGTGGTATATCAAACAGATTGTTTTATGAAAACAAGCTTTTCGATGGAGTAACAGCAGAGGATCGTACTCCAGTAGTGGACGTTGTTCCCACTCTGTGTTTTTATAACGTGGCGAAAGGAAAGGAGAAATGTGGACGAGACGGAAGCTACTACAACGAGGAGGAGGCAAAATTTGTTGTCTTTCTTATTGAATGCCTCCTGGAATCTGGCGTGGAACCAGCACAGATTGGAGTGATCACGCTGTACAAGTCCCAGCTTCACACAATATCTAACAATTTAACAGCTTCCAGGGCCACCTCTCACGCCGAACTCAAATCCATTCAGATATCGACAGTTGACGCATTCCAGGGCGGTGAAAAGGATCTCATTATTTTGTCGTGCGTGCGCACGGATCACATCGGATTTATTGACTGTGACAGACGCACCAATGTTGCGCTATCAAGAGCGAAAAGGCATCTCCTTATTGTTGGTAATTTGAAGATGCTTTCGTGTAACACTGTTTGGGGAAAAGTTATCGATTATTGTCGAGAGTTTCCCGGCGGACTCTGTAACTCACAAGACTTTATGAAGAAATGGAGGAAAGAAGATGTCAATGATTTGAGAGAGAGCCCTGTCATCAAAGAGTCCTGTCCACCAGAAACAACAGAGAAAACCGGCCAAATAGACAATGGTAAAGAACGAAACCGGGCGCCATCTATTTCAAAACCTGTCAGCGCGCCCGCATTAAGTAAAGAAACAGAAACAAATGCAACACAGTGTACTCCAGAAATCGGCAGCTTGGTATCTACTAACTCGGTTTCTCTTCTTCCATCTCAAGCCCCCTGTTCAGACATTTTGGAAAACGGCACCACGGAAGATGATAGTGATGACGAACTGCCGACTTTTGACATATTCTCTTCTTTTGGAATTGAGCCGGTCTAG

Transcript

OS493_036638-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q0VGT4	5'-3' DNA helicase ZGRF1 OS=Mus musculus OX=10090 GN=Zgrf1 PE=1 SV=2
Q86YA3	5'-3' DNA helicase ZGRF1 OS=Homo sapiens OX=9606 GN=ZGRF1 PE=1 SV=3
Q9HEH1	Regulator of nonsense transcripts 1 homolog OS=Neurospora crassa (strain ATCC 24698 / 74-OR23-1A / CBS 708.71 / DSM 1257 / FGSC 987) OX=367110 GN=2E4.130 PE=3 SV=1

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0003029 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF06839 all species →	zf-GRF	GRF zinc finger	Domain	Interproscan
PF10382 all species →	DUF2439	Protein of unknown function (DUF2439)	Family	Interproscan
PF13086 all species →	AAA_11	AAA domain	Domain	Interproscan
PF13087 all species →	AAA_12	AAA domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR027417 all species →	Homologous_superfamily	P-loop containing nucleoside triphosphate hydrolase	Interproscan
IPR010666 all species →	Domain	Zinc finger, GRF-type	Interproscan
IPR045055 all species →	Family	DNA2/NAM7-like helicase	Interproscan
IPR018838 all species →	Domain	5'-3' DNA helicase ZGRF1-like, N-terminal domain	Interproscan
IPR047187 all species →	Domain	Upf1-like, C-terminal helicase domain	Interproscan
IPR041677 all species →	Domain	DNA2/NAM7 helicase, helicase domain	Interproscan
IPR041679 all species →	Domain	DNA2/NAM7 helicase-like, C-terminal	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR10887 all species →	DNA2/NAM7 HELICASE FAMILY	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0008270 all species →	Molecular Function	zinc ion binding	Interproscan
GO:0000184 all species →	Biological Process	nuclear-transcribed mRNA catabolic process, nonsense-mediated decay	Interproscan
GO:0003724 all species →	Molecular Function	RNA helicase activity	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0004386 all species →	Molecular Function	helicase activity	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_036638-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_036638-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

106TPM > 0

7Conditions

32.8Max TPM

2.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	17	1.31	1.97
polyp at pH7 6	18	16	1.22	3.33
coral polyp · control treatment	16	16	4.45	32.85
coral polyp · oil and dispersant treatment	16	16	3.28	20.74
coral polyp · oil treatment	16	16	2.63	7.88
coral polyp · dispersant treatment	16	16	2.23	7.04
Polyp	10	9	1.34	2.33

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.97
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.97
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.77
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.77
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.70
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.52
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.51
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.36
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.35
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.26
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.25
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.20
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.16
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.15
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	1.01
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.82
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.77
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	0.00
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.33
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.05
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.17
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.56
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.51
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.34
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.30
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.26
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.10
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	1.08
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.99
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.85
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.73
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.71
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.54
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.47
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.85
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.20
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.66
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.66
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.29
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.90
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.70
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.64
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.60
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.60
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.46
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.31
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.22
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.14
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.04
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.88
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	20.74
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	5.17
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.58
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.75
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.44
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.55
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.34
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.56
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.41
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.31
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.17
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.16
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.03
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.02
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.67
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.62
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.88
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.21
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.12
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.65
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.58
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.31
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.22
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.21
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.13
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.89
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.80
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.45
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.21
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	1.18
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.95
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.36
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.04
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.96
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.27
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.17
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.75
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.85
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.84
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.78
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.73
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.68
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.38
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.23
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.17
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.11
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.05
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.76
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	2.33
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	2.32
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	1.68
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	1.54
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	1.52
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.48
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	1.04
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	0.77
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	0.68
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	0.00

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.