Gene detail

Detailed information of OS493_036674-T1 in Lophelia pertusa

Genomic Location: scaffold_378:220884...240884
NR annotation: KAJ7319161.1, hypothetical protein OS493_036674 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_036674-T1

ATGGGACCAAAACCATCAAGTTTAACACCAACCTATGTCCAGTCTCTTAATGTCAATATTCCTCATAATAACCCCAGTCAGCAAATTCCTTTGCATCTTCAAACTAACGCCTCAAGTTTTTCAGCTTTGCCAACTTCATTTACACAGCCAAGGATCCCTGCGTCTCTTCCTTTCCATCAACCTTCATCACAACAAATGCCTAATGGACTTCTGCAAGTCAGACCTGATTATTCTCAGGGAGTGTCATTACCATCACCAACCCAACTGATTATACCTGGAGAAATCAAGTTCCCTCCATTTTGCTGTGTTGGTGTCTTGACAGAGAGTGTCATTCCACTACATAACAGTAGCAGTCGATGGATGCATTGTGAAATACACTCTATTTTGTCTACTGCTAATGGCATTCAGGTTCCCAGTAGTGCAAGTGCATTCTCTCATCAACCAAAAGCTATCATAGCTCCACACATGACTGAAAACATCAAGATAAGTATCGAACCCCATGAAGCTGGTACATTCACTGCGCAGCTCCAGGTTTATTCATTCCCTGTGGTGTGTGAAGTACAACCAGTGACACATAGCCTGGGACCAGTATTGGCTTTAGAGGTTGTAGCAGAAGAACCTAACGTAGAGGTTGTTCTTGAGGATGACAATACCATACACTTTGGCGAGGTTTCATGTGGGGCTAAGCAATGTCGACCAATGCATCTGGTAAACAGAGGAAGAGCCCAAGTACCCATTCGAATCATTATATCTGCAAATAGTAGCTCACTGCACTGTTTTGCTTTTGCGGATGCGGATTTTTCACCAAAGACTGATGTTGTGAGAGGTCCTGCCCCTGCTGGAGGTAAGGGAGCAGCATTAACAATCCATACCCTGTCTCTAAAAGGACGGAAAGATCCGACCTCCAAAGTTGAGCCAACTGTTGTGTGGCTTCTGTTTCAGTCTCCAAAGATTGGACTTAACAGTACCACATCTGCTGGACCACCAGATGAGTACATTGCACGTCTTGATGTTGAGATTGACAGTGCTAGACAAGGTCCTACCATCAGCAGTGTTGCTCTTAAAGCTCTTGAGGGTATTGTTAGACTTCACACTCCTCATAAACTACAGGTGTTGGCTCTTAAGAGTTCAGTTGGCAAGAGTTCAAGCTGTACTATTCCAGTAAAGAATGCTGGTAACATCACAGCCAAAGTAAAGCTGAAGATTGAAGGAGACTCTCAACAATTCTCTGTGAAACCTACCCAGCTACGTCTGAAACCTGAAGAGGAGTCTGAAGTACAAGTCATGTTCCAACCCACAGAAGCAAATAAACAAGTAGAAAGCTTGGTAGTTCTAGCAGTTCCCAATGGGCCAGTGTATGAATTAGTGGTGAAGGGATCAGCAATACCAAAAGAAGATGACAAGTTTACCTTGTTGAGTAGTAAGCCAGTTCTCTGTTGGAGTGGAGTTGCACTGGGATGGTCTCAGCAGCAGAAGGTTATACTGAAAACAAGCTCTACGTCACCTGTAAAACTGCAACTATTGATTGAGGGAAATCACTCAGATTTTCAGATACAGCCAATGTTCAGTTCCCTTGGCGGAAGTCCTGAGCATCCTCAAGCAACCCTTGATCCAAAGAAGGAACTTCCAGTTCATGTTAGTTTTTCACCGTCATCCATGAGCCTCATCTCTAGCTCTCTGGTCATCAAGTCGCTTACAGGAAAAACAAAGTCTAAGATCCCACTTTATGGCTGTGGCGGAACAAGTCAGTTGGTGTTGGTGGATATTAGACAGCTCAGTGAGGGATATGTCACCAATGTTGGGGAGGTTTCTCTTGGAAAAAAGAATCATGTCAAAGTTGTAGTGAGAAATTCTGGCACAAGAGCAGCTTTTGTCAAGGCTGTGTGTTATTCAGATATCCATTCACTTCAACGATATCCTTCCAGTCACTTGAACATCCAACCAGACAGCTTTGTCCTCTCTGAAAGAACGTCAAAGGTTGTGTTGATTGAATACCAGCCTCTTGAGAAAGATGCCATCAACTGTCGCACATCTGTGAACTCTGTGGCTGTTGTTGCTTTCTACAATGGAGATGAGTTCTTGAGGCGGCAGTACAAAAAGAATCTTCAAACAACCCCTCGACAGCCGCCTTCTGATGTGTTGGAGAGAAGTCTTCTAGCAGGAGTTGATTTTACCACAACTTTTCAAGATGAGGACAAAGCTTGTAGAAGATGTGCAATACCCCAAGGCTCACCACCAGGTTCCAGTCCTGACATCAAATCTGATCCTAACAGATCAGTGGACATTGTGCCTGTCTCTGATAAACAGTCTGTGAAACCTAAACAAACAAGTCCAATTTCTAATGGTGATCCTGGTACTGAAAGTTGGACAGTAATTCCAGACTTTCTCACAATGTCACCCTGTAATTCAAATGACGACAAAAGTGGCAAAGGTTCTGATCAGCTTAGAATTGTCAACTTCTCTGATCGTTCAATGGGATTTGAGTTCACTTGGCCTGCACATTCCATTGTTATCACTCCAGAAAGAGGAGAAATTCCACCGAGGAGTCAGGCCAGAGTGCTAGTTAGTGCCAAGCCTAATCCCACCGACTCTTTCACTCATCTTCCTTGGGGAGGTACAATCTACGTGAAGTGTGATGGTAGGCAACAGTCCATCAGAGTGCAAATTAGAGAAGAGCAAGTCTTGGAGAGTTCTCCATACCAGTCTGGTGCATTAAATTTTCAGTCCATACCTACCACAATAGCTGGAAGCACACCACTTTCCACAAATCACTTACCTCCATTGAGAATCAAAAACAAAGATATCGTTTTTGTGAAGACATTGATTGGAACAGTGACAACATCAGAGATATCGCTAAGCAACACGGCATCTGCAGACATGACTTGGAACTTGTCTTCTGTGGCACCAGCTTATGTTAAGGTAGATGATACAGGAAACATTTGCAGGACAACGTACCTTGCTTTCAGCATGGCAAAACGTGAAGGGACAATACAAGCTGGAAGGACAACACAGATCATAGTTAAGTTTCAGCCTCGAGATGTTGGTGAATATGAGCAATCTTGGGACCTCATGACCACATCCAGTTCAAGTAAATCCAAGCAGAAAATATTTCTTCATGGCCAGGCTGTAGATAGAATTGGTGATTTTGAAGGAAAAGCAGAAGATGCCGACACTTACCCACCAACAAAATCAAAGAAAGTTACCATCAAAGAGCCATTGAGATCACCCAAGAGTACCAAAAAAGGACTGTATGTTGCAGAAAATGTGCGGATTGCATCTCTTAACAAGCCCTTCTCTGTTCAGAATACAAAGTTTTCAGTCAGACCTAACCGATTTGTTAGATTACCAGTGAGTTTCTCGCCCACTGAGGCAGGAAGGTCTTTTGAGGCATCATTGGTGATTACAGCTGATCCCGACGTCATTCTTACTGTGCAGCTTCAAGGGTCAAGTGCTGAGTGA

Transcript

OS493_036674-T1

Protein

UniProt (Swiss-Prot top hit)

UniProt accession	Description
Q8TEP8	Centrosomal protein of 192 kDa OS=Homo sapiens OX=9606 GN=CEP192 PE=1 SV=3

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0002742 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF15780 all species →	ASH	Abnormal spindle-like microcephaly-assoc'd, ASPM-SPD-2-Hydin	Domain	Interproscan
PF14646 all species →	MYCBPAP	MYCBP-associated protein family	Family	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR013783 all species →	Homologous_superfamily	Immunoglobulin-like fold	Interproscan
IPR039103 all species →	Family	Centrosomal protein Spd-2/CEP192	Interproscan
IPR031549 all species →	Domain	Abnormal spindle-like microcephaly-associated protein, ASH domain	Interproscan
IPR032707 all species →	Family	MYCBP-associated protein	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR16029 all species →	UNCHARACTERIZED	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0000242 all species →	Cellular Component	pericentriolar material	Interproscan
GO:0005737 all species →	Cellular Component	cytoplasm	Interproscan
GO:0005814 all species →	Cellular Component	centriole	Interproscan
GO:0007099 all species →	Biological Process	centriole replication	Interproscan
GO:0019901 all species →	Molecular Function	protein kinase binding	Interproscan
GO:0051298 all species →	Biological Process	centrosome duplication	Interproscan
GO:0071539 all species →	Biological Process	protein localization to centrosome	Interproscan
GO:0090222 all species →	Biological Process	centrosome-templated microtubule nucleation	Interproscan
GO:0090307 all species →	Biological Process	mitotic spindle assembly	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_036674-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_036674-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

109TPM > 0

7Conditions

32.3Max TPM

11.4Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	11.85	20.47
polyp at pH7 6	18	17	11.64	18.58
coral polyp · control treatment	16	16	12.83	32.29
coral polyp · oil and dispersant treatment	16	16	11.68	23.96
coral polyp · oil treatment	16	16	12.43	19.65
coral polyp · dispersant treatment	16	16	9.28	15.46
Polyp	10	10	9.22	15.76

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.47
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	20.01
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.58
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.25
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.54
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.99
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	12.69
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.98
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.85
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	11.00
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.77
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.28
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.26
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.18
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.10
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	7.56
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	5.88
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	4.90
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	18.58
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	17.71
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.91
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.71
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	13.02
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.99
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.83
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.69
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.40
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.06
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.63
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.57
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.59
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	10.35
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	8.89
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	6.79
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.80
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	0.00
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	32.29
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.33
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.23
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.16
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.69
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.02
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.99
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.83
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	11.47
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.94
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	10.56
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.26
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.25
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	8.28
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.65
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.33
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	23.96
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	15.52
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.24
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.46
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	12.18
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.75
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.67
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	11.63
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.99
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.69
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	10.11
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	9.71
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.66
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.60
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	8.20
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	7.44
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.65
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	19.49
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.69
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	15.19
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	14.31
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.64
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	12.97
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.37
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.16
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	11.15
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.97
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.81
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.62
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.42
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.51
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	4.90
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	15.46
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	13.37
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.83
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	11.64
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.90
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.87
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	10.22
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.88
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.39
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	9.34
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.44
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.19
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.09
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	8.09
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.52
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.29
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	15.76
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	15.59
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	13.13
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	12.79
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	9.85
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	7.27
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	6.81
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	5.03
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	3.01
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	2.98

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.