Gene detail

Detailed information of OS493_036816-T1 in Lophelia pertusa

Genomic Location: scaffold_385:152540...157887
NR annotation: KAJ7388588.1, hypothetical protein OS493_036816 [Desmophyllum pertusum]
Species Lophelia pertusa · all data for this species · gene families

Gene Structure

More details in JBrowse

Sequence

CDS

OS493_036816-T1

ATGGGGCGTGTATTTTCAGGTCTTCTTAGCCGAGCTTGTTTCTCTTTGCGGACGAAGCTCATTCAAGGTCGCTTTCCTCGAACTCATCTTCTGGTCATTATGGCGAGGCTGTGCTCTGTGGCTGCCCTTCTTCTATTTGTTTGTTTTGTGAGCTCAACATCTGTAACAGACGGGTTTGGGGATCCAAAATCCTGCGTTGGAAAATGTGGTATGAAGAGGTTGATTCATCCTGAAAGTACATTTTCCTCAAAAGTCCCTCGCAACCTTGTCGAATTCCTGAAGCACCAGGTCCCACACATGGTTCCACATAGCTGCTCAGAATTGGAATTCAGTGTTGCCTGGCTTCTTGATGACATTTACCACAATGTTAAGCACCCAGACTTCAAGTACATTCCTGAGGGACCCAAAGGAAAATCGACGCCTCTTCTCAACCCCAACCATATTGTCAGCCCATCTTCTGCAAAGGTGCAAAACTACATTGTGGCGCGCCCGATGGACTCCAGACATCCCCCAGAATCGGTCATCCACAAACAAGTTACACTCCACGGCGCTTTACGCAATTACAAGAAGGCCAAGGCGATGTTGATGTACTCACGCTTGCATCCAACTGTACAAGGAGCTAAGCAGATTTGCCACATCAAAGCAATTTTGAAGATTCCCATCATGGTGGTGTTCTCGATCCCAAGAAAAGAAGTGGCAAAGGCAAGGAAGAATCTGGCCATCTGCGGGATTGGAGTGATCCACTCTCCACCAAAACTGCCTCTGTCACTCTTAGTCAAATCACCCTTACCGATGCCGAACATTGACTATATCTTCCGCGGCTACAACCTCCTTTTTGGCAACCCTGTTGTTGACCCAACTCATGGACGTGACCCGGGTATCTCTCGCATGCCGATCTTCAAGGCCACCTTTGACAGAGGACTTACAACATCTGACATGAGGTATTTGATTCCCGATGGCATGTCTTTCCTGAAAGCAGTTAGCTGTAGAATTGACTTCGGCTCAACGGAGGACCGTAGTGAGAAATCTTACATTGATTCGCTATCCAACACTGTTGGAGCTGAAGCTGGATTCCTGGGATTCAACTTCAAGGCAAGCACAACGGTTCAGAAGAAGACCCAAGAGATCAAAAAAGCCAGTAACACATACGTCATTACCCAGGCTGTCTGCAGCGTTTACACTGGCGCCATCTTCATGGAGTTGCCTCCTCATCCTTCAGATGAATTCATAGCTTCACTTAAAAAATGCGAGAAGGACCCCTCGGAGGAGAACCTAAGAAATCTGGTCGACAACTATGGCACTCACTTCTTAACGGATGTCGTCATGGGGTCCAAGTTTGGTGAAGAAAGTCAAGTAACAACTGAATCATACGAGAAAATGGTGTCTGACGGACTTGACGTGGGGACCGCTGCTGGCTACTCTGGACGTTTCTCCGCAGGCGTGACAACAGAGACTGCCTCAGAGAAAGAGCAACGGGAAAAGTTCGAATCATCCCGGACGAGCAAGACCACCTACTCATATGGCTCTAACATTCCTCCTAATGGCGATCCTACCGTCTGGGCTTCAACGAGCTCTGACGACCCAATGCCTATCAACATGGAACTAAAGGCACTGACTGAACTGCTGACTGAAGAGTTCCTTGGGGACACAGGCATCGACTACAAAAAGTTGAAGCAACCGCTGATAGACTACTTGACCCAGTACTGCTCGAAGCTTGTGGATGAGGGCAAAGCAAAGGACTGTATGCCACCCACAGAATTTGCAACTAATGGTCCAGGCCTGAAGACGCTGATTCAGACAGACAGGGAAGTTATCGGTGCTGAAAAGATCGACGAAACCACCTTGGCAATGGTCCATGGCAATGTCTACAAAGGCTGGAAACTTGTGATTCGCAAGGACGGTTCAGAGGTAGCCTCCAAAGATTTGAGCGACAAGGACTTCGCCACTGACATGGTGGTGTGCCGTGGAAAACGCCGCCTTGGTGTTCTTCTTACCGACAACTATGAATACGCCCACATTGAGATGTATGAAGTCAGCGAGGATGGCAAGACAATCACCAAGAAAGACGTCGTCGACCTCCTTGACGTCGGAATGACACTAGAAGACATCGGCCATATGAATGTCAACAGCCTTTCGTACTACGCCGATGTCAACGGGTTTTTGATGGGAAAGCAAATGAGCAAAATTGAACTGTGGAAGATCGAAAGCATCTGTACCGAGGGTGGGTACGTCCGTGCAAAGCGTATCCTGAAAATGGAAAACTGGGATTACGTCATCGGCCCATCTGCTCACCTGAGTGACAACATTTTCGTCGTGGCTTTACAGGGTCCTTACGAAAAGAAGGAGATTAAGATGGTGGAAGTGTTCGGCGAAACCAGCTACAATGACTCAATGACCACGATCAGATTTAAAGGTCCGTTGTACTGCACCGACCTGTACAAAGACCAGGATACCCTGTTCGCACTAGGAGCGGAGTGGTATGAAGAGCGAGGTCGGCTGGTGGCATTCCGATGGCTGAAGGAAGAGAAGAGGCTGGAGTATGCTTCTGATCTGTTGACCCCAGATTTCATGAAGGATACCGGATCCGACATCGGCGTTGTCTCGGTGTACGGCGACAAGGCCTACTACGGAGAAATGGGTGGCGCGGATAAGGGAAGAGTCTTGGAATACCAGTTCAAATACGAGTCGCAGTGA

Transcript

OS493_036816-T1

Protein

UniProt (Swiss-Prot top hit)

No Swiss-Prot hit above the reporting threshold for this gene.

Gene family

Family type	Membership / link
Orthogroup (gene family)	OG0000911 (this species only)

Pfam domain

Pfam accession	Pfam name	Description	Type	Source
PF01823 all species →	MACPF	MAC/Perforin domain	Domain	Interproscan

InterPro

InterPro term	Type	Description	Source
IPR020864 all species →	Domain	Membrane attack complex component/perforin (MACPF) domain	Interproscan

PANTHER

PANTHER term	Description	Source
PTHR45742 all species →	COMPLEMENT COMPONENT C6	Interproscan

Gene Ontology

GO term	Category	Description	Source
GO:0005615 all species →	Cellular Component	extracellular space	Interproscan

Search by domain instead of by gene. Any accession above (InterPro, Pfam, PANTHER, GO, KEGG) can be used as a query on the Functional Domain Search page, which searches all 148 annotated genomes at once.

KEGG pathway

No KEGG orthology assignment for OS493_036816-T1.

Searching by KO or pathway ID across all species is available on the KEGG Pathway page.

Expression pattern (RNA-seq)

Transcript abundance of OS493_036816-T1 across 110 RNA-seq samples of Lophelia pertusa. Values are TPM (transcripts per million) from the StringTie quantification; one bar is one sample, grouped and coloured by condition, sorted by expression within each group.

110Samples

110TPM > 0

7Conditions

492.7Max TPM

21.8Mean TPM

By condition

Condition	Samples	TPM > 0	Mean TPM	Max TPM
polyp at pH7 9	18	18	20.82	36.59
polyp at pH7 6	18	18	28.22	80.72
coral polyp · control treatment	16	16	6.36	16.21
coral polyp · oil and dispersant treatment	16	16	41.09	492.74
coral polyp · oil treatment	16	16	23.96	227.80
coral polyp · dispersant treatment	16	16	17.57	107.01
Polyp	10	10	9.16	35.52

Per sample · hover a bar for the full sample record · show / hide the sample table

SRA run	Condition	Tissue	Developmental stage	Treatment	Study	TPM
SRR11359494	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.59
SRR11359511	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.35
SRR11359510	polyp at pH7 9	not recorded	not recorded	not recorded	-	36.04
SRR11359495	polyp at pH7 9	not recorded	not recorded	not recorded	-	35.08
SRR11359509	polyp at pH7 9	not recorded	not recorded	not recorded	-	34.02
SRR11359508	polyp at pH7 9	not recorded	not recorded	not recorded	-	32.86
SRR11359507	polyp at pH7 9	not recorded	not recorded	not recorded	-	28.69
SRR11359506	polyp at pH7 9	not recorded	not recorded	not recorded	-	26.76
SRR11359519	polyp at pH7 9	not recorded	not recorded	not recorded	-	15.03
SRR11359522	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.49
SRR11359518	polyp at pH7 9	not recorded	not recorded	not recorded	-	14.30
SRR11359523	polyp at pH7 9	not recorded	not recorded	not recorded	-	13.40
SRR11359521	polyp at pH7 9	not recorded	not recorded	not recorded	-	10.78
SRR11359520	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.87
SRR11359497	polyp at pH7 9	not recorded	not recorded	not recorded	-	9.27
SRR11359496	polyp at pH7 9	not recorded	not recorded	not recorded	-	8.03
SRR11359498	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.97
SRR11359499	polyp at pH7 9	not recorded	not recorded	not recorded	-	6.25
SRR11359513	polyp at pH7 6	not recorded	not recorded	not recorded	-	80.72
SRR11359512	polyp at pH7 6	not recorded	not recorded	not recorded	-	74.67
SRR11359500	polyp at pH7 6	not recorded	not recorded	not recorded	-	38.41
SRR11359526	polyp at pH7 6	not recorded	not recorded	not recorded	-	36.28
SRR11359527	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.71
SRR11359501	polyp at pH7 6	not recorded	not recorded	not recorded	-	34.70
SRR11359502	polyp at pH7 6	not recorded	not recorded	not recorded	-	33.39
SRR11359503	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.34
SRR11359515	polyp at pH7 6	not recorded	not recorded	not recorded	-	32.30
SRR11359514	polyp at pH7 6	not recorded	not recorded	not recorded	-	31.93
SRR11359529	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.78
SRR11359528	polyp at pH7 6	not recorded	not recorded	not recorded	-	16.61
SRR11359505	polyp at pH7 6	not recorded	not recorded	not recorded	-	12.65
SRR11359504	polyp at pH7 6	not recorded	not recorded	not recorded	-	11.73
SRR11359525	polyp at pH7 6	not recorded	not recorded	not recorded	-	9.12
SRR11359524	polyp at pH7 6	not recorded	not recorded	not recorded	-	5.91
SRR11359516	polyp at pH7 6	not recorded	not recorded	not recorded	-	3.16
SRR11359517	polyp at pH7 6	not recorded	not recorded	not recorded	-	2.50
SRR16705943	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	16.21
SRR16705974	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	15.31
SRR16705973	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	14.42
SRR16705965	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	12.14
SRR16705989	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	9.47
SRR16705972	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	7.15
SRR16705970	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.59
SRR16705990	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	5.20
SRR16705975	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	4.58
SRR16705971	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.62
SRR16705942	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.37
SRR16705960	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	2.13
SRR16705991	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.99
SRR16705946	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.01
SRR16705992	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	1.00
SRR16705957	coral polyp · control treatment	coral polyp	polyp	control treatment	SRP344271	0.61
SRR16705997	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	492.74
SRR16705976	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	80.79
SRR16705977	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	28.25
SRR16705948	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	19.55
SRR16705944	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	13.97
SRR16705995	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	4.01
SRR16705996	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.89
SRR16705945	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	3.12
SRR16705979	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.13
SRR16705993	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	2.13
SRR16705982	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.96
SRR16705978	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.60
SRR16705994	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.18
SRR16705947	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	1.01
SRR16706004	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.67
SRR16706005	coral polyp · oil and dispersant treatment	coral polyp	polyp	oil and dispersant treatment	SRP344271	0.41
SRR16705950	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	227.80
SRR16705949	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	54.35
SRR16705951	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	29.57
SRR16705952	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	16.68
SRR16705963	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	13.96
SRR16705983	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	10.41
SRR16705984	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	7.67
SRR16705964	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	6.84
SRR16705999	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.72
SRR16705961	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	3.65
SRR16705998	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.63
SRR16705980	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.22
SRR16705981	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	2.14
SRR16706000	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.74
SRR16706001	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.72
SRR16705962	coral polyp · oil treatment	coral polyp	polyp	oil treatment	SRP344271	0.20
SRR16705988	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	107.01
SRR16705969	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	89.81
SRR16705956	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	54.38
SRR16705968	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	7.54
SRR16705985	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.88
SRR16706002	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	4.06
SRR16705967	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	3.21
SRR16705987	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	2.40
SRR16705955	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.99
SRR16705954	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	1.90
SRR16705966	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.97
SRR16706003	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.91
SRR16705986	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.66
SRR16705953	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.60
SRR16705959	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.48
SRR16705958	coral polyp · dispersant treatment	coral polyp	polyp	dispersant treatment	SRP344271	0.33
SRR7746666	Polyp	not recorded	not recorded	not recorded	-	35.52
SRR7746669	Polyp	not recorded	not recorded	not recorded	-	25.23
SRR7746668	Polyp	not recorded	not recorded	not recorded	-	12.41
SRR23025709	Polyp	not recorded	not recorded	not recorded	-	5.01
SRR23025713	Polyp	not recorded	not recorded	not recorded	-	3.81
SRR23025708	Polyp	not recorded	not recorded	not recorded	-	2.65
SRR23025711	Polyp	not recorded	not recorded	not recorded	-	2.55
SRR7746667	Polyp	not recorded	not recorded	not recorded	-	2.01
SRR23025712	Polyp	not recorded	not recorded	not recorded	-	1.27
SRR23025710	Polyp	not recorded	not recorded	not recorded	-	1.16

Source: CnidoSite RNA-seq expression matrices (LPERT_TPM, StringTie quantification over 110 runs), joined to SRA sample metadata. Samples whose tissue/treatment is not recorded in the source metadata are grouped by the descriptor carried in the expression matrix itself.